ID: 1053200245

View in Genome Browser
Species Human (GRCh38)
Location 9:36147320-36147342
Sequence CTGGACCTAGGGAGAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 290}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053200245_1053200249 -9 Left 1053200245 9:36147320-36147342 CCCTCTGCTCTCCCTAGGTCCAG 0: 1
1: 0
2: 2
3: 31
4: 290
Right 1053200249 9:36147334-36147356 TAGGTCCAGCCTGAGATACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053200245 Original CRISPR CTGGACCTAGGGAGAGCAGA GGG (reversed) Intronic
900031375 1:375344-375366 CTGGACCAAGGAAGGGCAGGTGG - Intergenic
900051926 1:603544-603566 CTGGACCAAGGAAGGGCAGGTGG - Intergenic
900330550 1:2132396-2132418 CGGGCCCTAGGGGGAGCAAATGG + Intronic
901203763 1:7482392-7482414 CTGGACCTAGGGGCAGCTGTGGG - Intronic
901217822 1:7564697-7564719 CTGGACACTGGGAGGGCAGAGGG - Intronic
902561335 1:17279516-17279538 CTTGACCAAGGGAAAGGAGAGGG - Intronic
903438673 1:23370971-23370993 CTGGGCCTAAGGTGAGCTGAGGG + Exonic
903649186 1:24912763-24912785 CAGGCTCTAGGGAGAGCAGGTGG - Intronic
903745056 1:25581306-25581328 CTTGAGCCAGGGAGAGGAGAGGG + Intergenic
903779590 1:25812806-25812828 CTGGATCTAAGGGGAGCAGTGGG + Intronic
903906787 1:26693454-26693476 CTGCCCCTAGGGAAAGCTGATGG + Intergenic
904079242 1:27861730-27861752 CTGCATTTAGGAAGAGCAGAGGG + Intergenic
904479107 1:30783048-30783070 CTGGCTCCAGGGAGAGCAGAGGG - Intergenic
906642212 1:47448307-47448329 CTAGCCCTAGGCAGAGCAGAAGG + Intergenic
906789586 1:48647009-48647031 CTGGGCCTTGGGGAAGCAGAAGG - Intronic
912604797 1:110978916-110978938 CTGGGGCTAGGGAGAAGAGAGGG + Intergenic
912849672 1:113112017-113112039 CTGGAACTAGGGAAAGCAGAAGG - Intronic
913060174 1:115197392-115197414 CGGGACCTAGGTGGAGAAGAGGG - Intergenic
913104383 1:115598376-115598398 CTGGAACTCAGGAGAGCTGATGG - Intergenic
913164114 1:116169318-116169340 GTGGAGCTAGAGAGGGCAGATGG - Intergenic
913248427 1:116890898-116890920 CAGGGGCTGGGGAGAGCAGAAGG - Intergenic
918073203 1:181148965-181148987 CTGGACCAAAGAACAGCAGAAGG + Intergenic
919933636 1:202237222-202237244 CTGGATGGAGGGAGAGGAGAGGG - Intronic
920837984 1:209529679-209529701 CTGAGCCTGGGGAGAACAGATGG + Intergenic
922602210 1:226865004-226865026 CTGGAGCAAGGGACAGCAGATGG + Intergenic
922698684 1:227745310-227745332 CTGCACCTGGGGAGAGGGGAAGG - Intronic
922862933 1:228834804-228834826 CTGGAGCTGGGCAGACCAGAAGG + Intergenic
922923730 1:229330319-229330341 CTGGAGCTCAGGAGAGAAGATGG + Intronic
922936524 1:229426963-229426985 CTGGAGCTGGGGAGAGAAGCAGG + Intergenic
923121893 1:230999606-230999628 CAGGACCTAAGGAGAGCATAAGG - Intronic
924809715 1:247390229-247390251 CTTAACCTGGGGAGGGCAGAGGG + Intergenic
1063410823 10:5835304-5835326 CTGCATCTTGAGAGAGCAGAGGG - Intronic
1069547541 10:69339332-69339354 CTGGTCCTCGGGAGATCAGAAGG - Intronic
1070154374 10:73824583-73824605 CAGGAACTAGGGAAGGCAGAAGG - Intronic
1071718500 10:88120174-88120196 CAGGAACGAGGGGGAGCAGAAGG + Intergenic
1071899255 10:90101440-90101462 CTGGACCTACCCTGAGCAGAAGG + Intergenic
1072451873 10:95545132-95545154 CTGGAGCTTGGGAGAGCTGAGGG - Intronic
1072507538 10:96083777-96083799 TTGGATCTGGGGAGAGCAGCTGG - Intergenic
1072959963 10:99920497-99920519 CTAGATCTTGGGAGAGCAGCAGG + Intronic
1073440422 10:103549353-103549375 CTGGAGCCAGGGAGCCCAGAGGG - Intronic
1074354207 10:112767852-112767874 CTGGTCCTAGGAAGAGGTGAAGG - Intronic
1074628182 10:115218011-115218033 ATGGACCCAGGGAGGGGAGATGG + Intronic
1074724747 10:116296544-116296566 CTGGACCTTGGAAGAGAAGACGG - Intergenic
1075408575 10:122211038-122211060 CTGGACTCAGAGAGTGCAGAAGG + Exonic
1076800935 10:132827869-132827891 CTGGATCAAGGGAGTGCACAGGG - Intronic
1076832714 10:133004705-133004727 CAGGACCTAGGGAGGGCCCACGG - Intergenic
1078107879 11:8370086-8370108 CTGGCCCTTGGGAGGGCAGGTGG - Intergenic
1078324754 11:10370395-10370417 CTGGAGCTGGAGAGGGCAGAGGG + Intronic
1078396348 11:10985252-10985274 CTAGAGCTAGGGAGACCAGAGGG + Intergenic
1078432957 11:11301779-11301801 CTGGGCATTGGGAAAGCAGAGGG + Intronic
1078702283 11:13697858-13697880 CTGGACCTAGTGAGAAAACAAGG - Intronic
1079275306 11:19030068-19030090 CTGGACCCAGAGAGAACACATGG + Intergenic
1080757955 11:35220212-35220234 CTGTCCCAAGGGAGAGCACAGGG + Intronic
1081256730 11:40905636-40905658 CTGGACTTGGGGAAATCAGAAGG - Intronic
1081611166 11:44564526-44564548 CTGGAGCCTGGGAGGGCAGAGGG + Intronic
1083172335 11:60930403-60930425 CTGGAGCCAGGGAGGTCAGATGG + Intronic
1083272244 11:61578439-61578461 CTGGCCCCTGGGAGACCAGAGGG + Intronic
1083307982 11:61770626-61770648 ATGCACCCAGGGAGGGCAGAAGG + Intronic
1083799763 11:65039840-65039862 CAGGCCCTGGGGAGAGGAGAAGG - Exonic
1083912598 11:65719030-65719052 CTGGCCCTGGGCAGAGGAGATGG - Exonic
1088019219 11:105099416-105099438 TTGGACCTAGAGAAAGAAGAAGG + Exonic
1089082293 11:115787048-115787070 CTGGACTGAGGCACAGCAGATGG + Intergenic
1089661973 11:119991773-119991795 CTGGACCTGGGCAGGGCAGCAGG - Intergenic
1091641062 12:2237888-2237910 GTGGAGCTAGGGAGGGCAGAGGG - Intronic
1094030416 12:26005888-26005910 CTGGACTTAGGAAGATCACAGGG - Intronic
1094341863 12:29420951-29420973 TGTGACATAGGGAGAGCAGATGG + Intronic
1097198251 12:57256441-57256463 ATGGAGCAAGGGAGGGCAGATGG + Exonic
1097770837 12:63582864-63582886 GAGGAGCTAGGGAGAGCAGGAGG + Intronic
1097970648 12:65629664-65629686 CTGGACCTGGGTAGAGGAGAGGG - Intergenic
1098198786 12:68032429-68032451 CTGGACAGAGTGAGAGCAGGAGG + Intergenic
1098591786 12:72222757-72222779 GTGGTCCTAGGGAGATCAGTGGG + Intronic
1099188282 12:79539403-79539425 CTGATCCTTGGGAGAGCAGAGGG + Intergenic
1100891487 12:99131159-99131181 CTGGATGTTGGGAGAGCAGGTGG - Intronic
1102288094 12:111675933-111675955 CAGGACATAGGAAAAGCAGAAGG - Intronic
1102582728 12:113901196-113901218 CTGTACCTAGGGAAATCAAAAGG - Intronic
1103820129 12:123691231-123691253 CTGGAACTAGAGAGAGGTGATGG - Intronic
1105525801 13:21176845-21176867 CCGGACCTGGAGAGAGCAGCGGG - Intronic
1105886535 13:24647449-24647471 CTGGGCCTGGGGACAGCAGCAGG + Intergenic
1106698723 13:32206243-32206265 CTGGTCCGAGGAAGAGCAGAAGG + Intronic
1108454594 13:50600221-50600243 CTGGACCTTGGTAGATCAGATGG - Intronic
1112170070 13:96962230-96962252 CTGGACCAATGGAGAGAACAGGG + Intergenic
1112996912 13:105585657-105585679 CTTGACCTATGCAGAGGAGATGG - Intergenic
1113137888 13:107113833-107113855 CTGGCCCAAGGGTGAGCAAAGGG - Intergenic
1113574905 13:111388475-111388497 CTGGACCGAGGCCCAGCAGAGGG - Intergenic
1113576693 13:111399996-111400018 CTGGACCAGGGGTGAGCACAGGG + Intergenic
1113885162 13:113655034-113655056 CTGGAACTAGGTAGGGAAGATGG - Intronic
1118145747 14:63134042-63134064 CAGGAGCTGGGGAGAGCAGTTGG + Intergenic
1118810742 14:69271318-69271340 ATGGAACTTGGGAGATCAGAAGG + Intronic
1121046457 14:90791698-90791720 CTGGACCTTGGCAGTGCTGATGG + Intronic
1121735204 14:96213642-96213664 CTAGACCTAGGTAAAGTAGAGGG + Intronic
1122116591 14:99530639-99530661 CAGGCCCAAGGGACAGCAGAGGG + Intronic
1122178539 14:99938200-99938222 ATGGACCTAGGTGGACCAGATGG + Intronic
1122730644 14:103794767-103794789 CTGGATCTAGGAAGAAGAGAAGG - Intronic
1125267032 15:37893782-37893804 CTTGAACTAGGGAAAGGAGAAGG - Intergenic
1125750286 15:42023225-42023247 CTGGCCCTCCAGAGAGCAGAGGG - Intronic
1126194286 15:45914375-45914397 TTAAACCTAAGGAGAGCAGAAGG - Intergenic
1126541759 15:49831787-49831809 CTGGCCCTGGGGGGAGGAGAAGG - Intergenic
1127759624 15:62125843-62125865 CTGGGCCAAGGGGTAGCAGAAGG - Intergenic
1129224799 15:74162867-74162889 CTGGGCCTAGGGCAAGCAAAGGG - Intergenic
1129806524 15:78464930-78464952 CTGGAACTAGGGAAAGGGGAAGG + Intronic
1130295786 15:82646696-82646718 GAGGACCCAGGGAGACCAGAAGG - Intronic
1130605844 15:85315934-85315956 ATAGAACTAGGGATAGCAGAAGG - Intergenic
1130924622 15:88375715-88375737 CTGGCCCTTGGGAGACCTGATGG + Intergenic
1131508612 15:93036623-93036645 CTGGTTCTGGGGTGAGCAGAGGG - Intronic
1131753425 15:95534715-95534737 CTAGACCTAGGAAATGCAGAAGG + Intergenic
1132831998 16:1932994-1933016 CTGGAGCTGCGGAGAGCAGGGGG - Intergenic
1136545344 16:30951149-30951171 CTGGGCCTGGGGAAAGAAGAAGG - Intronic
1137444967 16:48526063-48526085 CTGGAACTAGGGATGGCAGGAGG - Intergenic
1137646543 16:50080058-50080080 CTGGAGGAAGGGAGAGCACAGGG + Intronic
1138095636 16:54209219-54209241 CAGGACCTAGACAGAGCAGATGG + Intergenic
1138193193 16:55033446-55033468 CTGGAACCAGGGACAGGAGAGGG - Intergenic
1138329410 16:56201555-56201577 CTGGAGGTTGGGAGACCAGATGG + Intronic
1138489846 16:57370399-57370421 CTGGACCTGGGGAGGGTAGAGGG + Intergenic
1139261166 16:65595676-65595698 CAGGGCCAAAGGAGAGCAGAGGG - Intergenic
1141825165 16:86473584-86473606 CTGAACCTAAGGAGAGGAGGGGG - Intergenic
1144453786 17:15402795-15402817 GTGGTCCCAGGGAGAGAAGACGG + Intergenic
1145029383 17:19493111-19493133 CTGGAGCAAGGGAAAACAGATGG + Intergenic
1147154425 17:38536524-38536546 ATGGACCTGGCGAGAGCAGGTGG - Intronic
1147488846 17:40844841-40844863 CTGGACAAAGGGAGATGAGATGG + Intergenic
1147995954 17:44360630-44360652 CCGGGCCTGGGGAGAGGAGAAGG + Intronic
1148127034 17:45242263-45242285 CTGGGCCCAGGGAGGGCTGATGG - Intronic
1150067598 17:62124643-62124665 CTAGACCAAGAGAGAGCAGGTGG + Intergenic
1150250965 17:63704298-63704320 CTGGGCTTCGGGAGAGCAGAGGG - Intronic
1152125859 17:78446267-78446289 CTGGAACTAGAGAGTGCTGATGG - Intronic
1152948278 17:83210369-83210391 CTGGACCAAGGAAGGGCAGGTGG + Intergenic
1154129809 18:11727132-11727154 GGGGACCCAGTGAGAGCAGAGGG - Intronic
1157301440 18:46482696-46482718 CTGGACCTAGGCAGAGCCCTCGG - Intronic
1157566041 18:48679965-48679987 CTGTATGTAGGGAGAGCAGTTGG + Intronic
1158869368 18:61669780-61669802 CTGGACCTAGGGATGGAAGGAGG - Intergenic
1160364531 18:78313027-78313049 CTGCCCCTGGGCAGAGCAGAGGG + Intergenic
1160951346 19:1669038-1669060 CTGGTCCTGGGGAGGGCAGCTGG + Intergenic
1161439589 19:4283101-4283123 CAGGACCCAGAGACAGCAGATGG + Exonic
1161783213 19:6307285-6307307 CTGGTCCTAGAGAGGGGAGAGGG + Exonic
1161797102 19:6393547-6393569 CTGGACCTGGGGGGCCCAGAAGG + Intronic
1161851573 19:6740313-6740335 CTGGGCCTGGGGTGAGCAGGGGG - Intronic
1162042830 19:7980756-7980778 CTGGCCCCAAGGAGCGCAGAGGG + Intronic
1162161567 19:8721697-8721719 CTGGACCTCTAGATAGCAGAAGG + Intergenic
1163529714 19:17842315-17842337 CTGGACCCAGGGAGAACAGGAGG - Exonic
1163777613 19:19227373-19227395 CTGGAGCTAGAGAAAGCCGAGGG + Exonic
1164620732 19:29694722-29694744 CGGGACCTGGGGAGAGGAGGAGG + Intergenic
1164946223 19:32295288-32295310 CTGGACCATGAGAGTGCAGAAGG - Intergenic
1165361290 19:35338451-35338473 CTGGTTCTAGGGAGAGAAGATGG + Intronic
1165411592 19:35665712-35665734 CTGGACCGAGGCAGAGCAGTGGG - Intergenic
1166388879 19:42397758-42397780 CTGGATCTTGGAGGAGCAGAAGG + Intergenic
1167305763 19:48708478-48708500 CTGGACCAAGGGGGATCAGATGG - Intergenic
925320225 2:2960551-2960573 CTGGACTTGGGGAGATCAGATGG - Intergenic
927138223 2:20112805-20112827 CTGGGCCGAGGGAGAGGACAGGG + Intergenic
928200854 2:29246814-29246836 CTGGAGGTGGGGAGAGCAGTTGG - Intronic
931462148 2:62458356-62458378 CTGGAGCCAAGGGGAGCAGAAGG - Intergenic
931587692 2:63846116-63846138 CTGGAGCAAGGAAGAGCAGAAGG - Intronic
932177899 2:69619420-69619442 CTGAACCTTGGGAAAGAAGAGGG - Intronic
934149665 2:89134403-89134425 CAGGACTGAGGGAGAGCGGAGGG - Intergenic
935481227 2:103592567-103592589 CTTGACCTTGAGAGACCAGAGGG + Intergenic
936343500 2:111657850-111657872 CTGGTCCCAGGGAGAGCATGGGG - Intergenic
937059313 2:118969966-118969988 CAGGACCTAGCGTGAGCACACGG - Intronic
937167696 2:119836655-119836677 CTGGACCCCGCGAGAGCACAGGG - Intronic
937431655 2:121843834-121843856 GAAGAACTAGGGAGAGCAGAAGG - Intergenic
941417109 2:165234409-165234431 TTGAACCTACGGAGGGCAGATGG - Intergenic
941536609 2:166730052-166730074 GTGGACCTAGGGAAAGAAAAAGG - Intergenic
941860299 2:170272383-170272405 CTGGAAGTAGGGAGACCAGCTGG - Intronic
941968839 2:171328206-171328228 CTGGATAGAGGGAGAGGAGAAGG + Intronic
944355163 2:198778891-198778913 CTGCATCCAGGGAGAGCTGATGG - Intergenic
945395238 2:209307846-209307868 CTGCACCCTGGGAGTGCAGAAGG + Intergenic
946247092 2:218394103-218394125 CGGGAGCTGGGGAGAGCAGCAGG - Exonic
947211827 2:227715666-227715688 CTAGTCTTAGGGAGAGCAGGAGG + Intronic
947752111 2:232538609-232538631 CTGCATCTAGGGGGACCAGAGGG + Intergenic
947933966 2:233987573-233987595 CTGGACACTGGGAGACCAGATGG - Intronic
948234688 2:236379354-236379376 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234704 2:236379398-236379420 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234720 2:236379442-236379464 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234736 2:236379486-236379508 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234752 2:236379530-236379552 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234768 2:236379574-236379596 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234784 2:236379618-236379640 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234800 2:236379662-236379684 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234816 2:236379706-236379728 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234832 2:236379750-236379772 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234848 2:236379794-236379816 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234862 2:236379838-236379860 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948234878 2:236379882-236379904 CAGGACCAAGGGAGAGGGGAGGG + Intronic
948434827 2:237945915-237945937 CTGGACGCATGGGGAGCAGAAGG + Intergenic
948982156 2:241499836-241499858 CTGGCCCTGCTGAGAGCAGACGG - Intronic
1171042841 20:21781647-21781669 CTGGCCCGAGGGAGAGCAGCTGG - Intergenic
1171426395 20:25051238-25051260 CTCGCCCTAGGGAGCGCAGCAGG - Intronic
1172330707 20:34074463-34074485 CTGGACAGAGGGAGAGAAGCAGG - Intronic
1172580215 20:36041496-36041518 CATGCCCTAGGGAGAGGAGATGG + Intergenic
1173367038 20:42395601-42395623 CAGGCCCAAGGGAGAGCAGCAGG - Intronic
1175738969 20:61407054-61407076 CTGTATCCAGGCAGAGCAGATGG - Intronic
1176138922 20:63536769-63536791 CGGGACCCAGGGAGGACAGAGGG - Intronic
1176213975 20:63939577-63939599 CTGGACCTAGGGAGGGGACAGGG - Intergenic
1177975127 21:27839279-27839301 CTGGACCTATGGAGGGCCAATGG + Intergenic
1178362538 21:31961104-31961126 CAGGGCTTAGGGAGAGCAGGAGG - Intronic
1179034918 21:37751403-37751425 CTGGGACCAGGGAGAGCAAACGG + Intronic
1179971553 21:44838695-44838717 CCAGGCCTTGGGAGAGCAGACGG - Intergenic
1181051490 22:20240219-20240241 CTGGATCTCAGGTGAGCAGAGGG + Intergenic
1183732713 22:39627708-39627730 CTCGGCTTGGGGAGAGCAGAAGG + Intronic
1184775530 22:46621016-46621038 CTGGTCCTGGGGAGAGCGGCTGG + Intronic
1184982754 22:48105832-48105854 CTGAAAGCAGGGAGAGCAGAGGG - Intergenic
950524899 3:13517856-13517878 CTGGACCCAGGAGGAGCAGCAGG + Intergenic
951460397 3:22945534-22945556 CTGGAATTAGGGAGGGAAGACGG + Intergenic
951819657 3:26794078-26794100 CTGGATCTAGGGGGAGGTGAAGG - Intergenic
952919960 3:38277355-38277377 GGGGACCTAGAGGGAGCAGAAGG - Exonic
954322349 3:49840727-49840749 CAGGAGCCAGGAAGAGCAGAGGG + Intronic
954874103 3:53789861-53789883 CTGAACACAGGGAGATCAGATGG - Intronic
956265238 3:67388998-67389020 CAGGACCTGGGTAGATCAGAAGG + Intronic
957768385 3:84657105-84657127 CAGGACCAAGAGAGAGCACAGGG - Intergenic
958266485 3:91443698-91443720 CTGGATCTTGGAATAGCAGAAGG + Intergenic
959883548 3:111473719-111473741 CTGGTGCTAGGGAGATTAGATGG - Intronic
960387330 3:117035957-117035979 CAGGTTCTAGGGAGAGCAGAGGG + Intronic
960461326 3:117939353-117939375 TTAGACATAGGGACAGCAGATGG - Intergenic
960868711 3:122228237-122228259 CTAGACCTAGGAAGAAAAGATGG - Intronic
961176206 3:124837187-124837209 CTTGGCCTAGGGAGGACAGAGGG - Intronic
961406632 3:126684325-126684347 CTGGATGGAGGGAGAGCAGGTGG + Intergenic
962010973 3:131390517-131390539 CTGGCCACAGAGAGAGCAGAGGG - Intergenic
962309292 3:134313880-134313902 CAAGACCTGGGGAGAGAAGAGGG + Intergenic
962471246 3:135711202-135711224 CTGGAGGAAGGGAGAGCTGAGGG - Intergenic
965536370 3:169827643-169827665 CTGGACCATGGGAGACCACATGG - Intronic
965660388 3:171036025-171036047 GTGGACCTTGAGAGAGCAAAGGG - Intergenic
965882121 3:173398211-173398233 GAGGGCCTGGGGAGAGCAGAAGG - Intronic
967843016 3:194022051-194022073 TTGGACCAAGTGAGACCAGAAGG + Intergenic
968587072 4:1423982-1424004 CTGGACTCAGAGAGAGTAGAAGG - Intergenic
971627913 4:28947290-28947312 CTGGAAGTAGGAAGAACAGATGG + Intergenic
977277156 4:94992028-94992050 ATGGAGCTGGGAAGAGCAGATGG - Intronic
981715635 4:147749036-147749058 CTGGGCCTAGGGACTGCACATGG + Intronic
982440716 4:155432778-155432800 CTGGGCTTTGGGAGAGCAGGAGG - Intergenic
986434718 5:7717860-7717882 CTGAACCCATGCAGAGCAGAAGG + Intronic
986696757 5:10363935-10363957 CTGGAACTGGGGAGAGCAGATGG + Intronic
987095499 5:14545863-14545885 TTCAGCCTAGGGAGAGCAGAAGG + Intergenic
990827877 5:59922450-59922472 CTCCACCTAAGGAGAGGAGAGGG + Intronic
994606157 5:101969324-101969346 CTCGACCCAGGCAGAGTAGAGGG + Intergenic
994812555 5:104540200-104540222 CTGGACCCAGAGAAGGCAGAAGG - Intergenic
995354533 5:111223744-111223766 CTGGACCCAGTGAGAGCTGGAGG - Intronic
996550722 5:124727245-124727267 CTTGACTTGGGGAGAGGAGAGGG - Intronic
997879166 5:137574258-137574280 CTGGACCAGGGTAGAGCAGGAGG - Intronic
999028280 5:148260193-148260215 TTGGACATGGGGGGAGCAGAAGG - Intergenic
999061490 5:148640304-148640326 CTGGAGCTAGGGATTGGAGAAGG - Intronic
999422464 5:151456852-151456874 CTGGACCTAAGGAGAGCCTTCGG + Intronic
1002100338 5:176854542-176854564 CTGGACCCTGGGGAAGCAGAGGG - Intronic
1002742445 5:181443524-181443546 CTGGACCAAGGAAGGGCAGGTGG + Intergenic
1002968789 6:1993127-1993149 CTGGGGCAAGGGAGAGGAGATGG - Intronic
1003035312 6:2636438-2636460 CTGGAACGGGGGAGAGAAGATGG - Intergenic
1004017853 6:11748724-11748746 CTGAGCCATGGGAGAGCAGATGG + Intronic
1004348494 6:14869972-14869994 CTGGAGCTTGGGAGAGGAGAGGG - Intergenic
1006989222 6:38199164-38199186 GGGGACCTAGGCACAGCAGAGGG + Intronic
1007337183 6:41162295-41162317 TTGGAACTAGAGAGACCAGATGG + Intronic
1008834411 6:55808314-55808336 CTGGACCCAGGGAGACTGGATGG - Intronic
1008988727 6:57577934-57577956 CTGGATCTTGGAACAGCAGAAGG - Intronic
1009177328 6:60476494-60476516 CTGGATCTTGGAACAGCAGAAGG - Intergenic
1011167120 6:84461368-84461390 CTGGACCTAAAGAGGCCAGATGG + Intergenic
1013837712 6:114352094-114352116 CTAGACCAGGAGAGAGCAGACGG + Intergenic
1016457915 6:144250374-144250396 CAGGACCTAGGGAAAGCAAAAGG - Intergenic
1016939103 6:149469911-149469933 CTAGGCCGGGGGAGAGCAGAAGG + Intronic
1016978629 6:149833308-149833330 GTGGTCTTAGGGACAGCAGAGGG + Intronic
1017718406 6:157228149-157228171 CTGGACCCAGGGAGTGTGGAGGG + Intergenic
1018340918 6:162850491-162850513 CTGAACCCAGGGAGGGGAGAGGG + Intronic
1019102291 6:169641225-169641247 CTGGAGCTCGGGAGAGGAGGGGG - Intronic
1019247581 6:170719263-170719285 CTGGACCAAGGAAGGGCAGGTGG + Intergenic
1019926464 7:4196337-4196359 CTGTAGCTAGGGAGTGCACAGGG - Intronic
1019975785 7:4580140-4580162 CTGGACTCAGGGACTGCAGATGG - Intergenic
1020410478 7:7886697-7886719 CTGGATGTAGGGAGATCAGTTGG - Intronic
1021577778 7:22120148-22120170 GTGGTCCTAGGGGTAGCAGAGGG - Exonic
1021839696 7:24712675-24712697 ATGAACCTAGGATGAGCAGAAGG - Intronic
1022190235 7:28010394-28010416 CGGGACCTAGGAACAGCAGAAGG - Intronic
1022930319 7:35105095-35105117 GAGGAGCTAGGGAGAGCAGGAGG + Intergenic
1023399304 7:39780256-39780278 AAGGAACCAGGGAGAGCAGATGG + Intergenic
1024533202 7:50409920-50409942 CTGGGCCTGGGCTGAGCAGATGG + Intergenic
1024651146 7:51404452-51404474 AAGGAACCAGGGAGAGCAGATGG - Intergenic
1025958249 7:66199120-66199142 CGGGACCCAGGGAGAACAGGAGG - Intergenic
1026226208 7:68443721-68443743 CTGGACCAAGAGACGGCAGAAGG - Intergenic
1027346608 7:77266725-77266747 CTGGACCTATGGAGAACAGCTGG - Intronic
1027890500 7:83967355-83967377 CTGGAGCTGGGGAGAGAAGGGGG - Intronic
1028181432 7:87729823-87729845 CTCCACCTAAGGAGAGGAGAGGG + Intronic
1030763451 7:113379647-113379669 CTGGACCTTCACAGAGCAGAAGG + Intergenic
1033080207 7:138289507-138289529 CAGGACCAAGGGAAAGCAAAAGG - Intergenic
1034078718 7:148257188-148257210 ATGGCCCTGGGGAGATCAGAGGG - Intronic
1035288788 7:157824093-157824115 CTGAACCCAGCGAGAGCACACGG + Intronic
1035500556 8:88673-88695 CTGGACCAAGGAAGGGCAGGTGG - Intergenic
1038406039 8:27323705-27323727 CAGAACCTAGGGAGACCTGATGG + Intronic
1041171478 8:55146841-55146863 CTGTATCAAGGGACAGCAGAAGG - Intronic
1042054487 8:64749487-64749509 CTGGACTGAGGGAGAGCAGTGGG + Intronic
1045976140 8:108132066-108132088 CTGGCCCTATGGCAAGCAGACGG - Intergenic
1047027565 8:120840661-120840683 CTGGGACTATTGAGAGCAGAGGG + Intergenic
1047801625 8:128316078-128316100 CTGGAGGTAAGGAGAGCAGGAGG + Intergenic
1047819389 8:128502130-128502152 GAGGACCTAGGAAGAGGAGAGGG - Intergenic
1048420521 8:134274057-134274079 CTGGACCCAAGGAGAGTAGTTGG + Intergenic
1048503367 8:134998748-134998770 CAGGGCCTAAAGAGAGCAGAAGG - Intergenic
1048828916 8:138457134-138457156 CTAGACCTAGGAAGAGAAGCAGG + Intronic
1049607549 8:143536696-143536718 ATGCTCCCAGGGAGAGCAGAGGG + Intronic
1050483153 9:6106850-6106872 CTGGGGCTGGGGATAGCAGAGGG + Intergenic
1053200245 9:36147320-36147342 CTGGACCTAGGGAGAGCAGAGGG - Intronic
1053516289 9:38733532-38733554 CTGGCCCTTGGGAGAGAAGGCGG - Intergenic
1057197333 9:93122292-93122314 CTGGAAGGAGGGAGAGGAGAGGG + Intronic
1057197341 9:93122322-93122344 CTGGAAGGAGGGAGAGGAGAGGG + Intronic
1057197349 9:93122352-93122374 CTGGAAGGAGGGAGAGGAGAGGG + Intronic
1057266787 9:93622569-93622591 CGGGAGCCAGGGAGTGCAGATGG + Intronic
1057298565 9:93863328-93863350 CTGGACCCAGGGAGCACAGCGGG + Intergenic
1057713328 9:97466997-97467019 CTGGACCAAAGGAGAACACAGGG + Intronic
1057897587 9:98922170-98922192 CTGGAACTAGGGTGAGGTGAAGG + Intergenic
1060115492 9:120936925-120936947 GAGGCCCTTGGGAGAGCAGAGGG - Intergenic
1060251634 9:121990942-121990964 CTGCAGCTATGGAGAGCGGATGG + Intronic
1060291938 9:122311300-122311322 CTGGACACAGGGAGGGCTGAGGG - Intronic
1060299695 9:122368069-122368091 CTGTAGCTAGGGTGAGCAGGAGG + Intergenic
1061531292 9:131215614-131215636 TTGGGCCTTGGGAGAGAAGAGGG - Intronic
1061875676 9:133542397-133542419 CTGGACCCAGGGCATGCAGAGGG + Intronic
1062138681 9:134943764-134943786 CAGGACCTCGGGAGGGAAGAAGG - Intergenic
1062177734 9:135173549-135173571 CTGGCCCTAAGGAGGGCAGCTGG + Intergenic
1062268712 9:135699271-135699293 CTGGACCCTGGGAGAGGGGAAGG - Intronic
1062549618 9:137079979-137080001 CTGGGGCACGGGAGAGCAGAGGG - Intronic
1203608352 Un_KI270748v1:74743-74765 CTGGACCAAGGAAGGGCAGGTGG + Intergenic
1185563161 X:1076176-1076198 CTGGACCTAGACAGAGGTGATGG + Intergenic
1185610194 X:1389722-1389744 CTGGACCTGGGGGACGCAGAGGG + Exonic
1185868737 X:3645566-3645588 CTGGAACTAGAGAGAGGTGATGG + Intronic
1189307695 X:39999395-39999417 CTGGACATCAGGAGACCAGATGG + Intergenic
1192245533 X:69368847-69368869 CTGAAACTGGGCAGAGCAGACGG - Intergenic
1193605923 X:83567517-83567539 CTGGAGCCAGGGAGACCAAACGG - Intergenic
1194720396 X:97333921-97333943 TTGGACATAGGGAGAGCATCTGG - Intronic
1195763317 X:108270457-108270479 CTGGTCCTAGGAAGAGAAGGAGG + Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199176901 X:144799433-144799455 CTGGAACTAGGGGTAGCAGAAGG + Intergenic
1199200244 X:145078844-145078866 CTGGACCCAGGGAAACAAGATGG + Intergenic
1199441573 X:147874542-147874564 ATGGAAGTAGGGAGAGAAGAAGG + Intergenic
1200062130 X:153488387-153488409 CCGGTCCTAGGCAGAGCTGATGG - Intronic
1200283642 X:154800279-154800301 CAGGAACTAGGGAGAGAGGAAGG + Intronic
1200403887 Y:2789323-2789345 CTGGAACTAGAGAGAGGTGATGG + Intergenic