ID: 1053200533

View in Genome Browser
Species Human (GRCh38)
Location 9:36148916-36148938
Sequence CAACCCCCACTCCTCGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053200533 Original CRISPR CAACCCCCACTCCTCGGCCT GGG (reversed) Intronic
900189235 1:1346287-1346309 CATCCCCCAGTCCCAGGCCTGGG + Intronic
900192660 1:1358078-1358100 CAGCCCCCGCTCCCAGGCCTGGG - Intronic
900245366 1:1633877-1633899 CAGCCCCCACAGCTCGTCCTGGG - Exonic
900256597 1:1701036-1701058 CAGCCCCCACAGCTCGTCCTGGG - Intronic
900409885 1:2507745-2507767 CCACCCCACCTCCTTGGCCTAGG + Intergenic
901913282 1:12478279-12478301 GAAGCCGCATTCCTCGGCCTGGG - Intronic
903435186 1:23344092-23344114 CCACCCCCACCCCGGGGCCTCGG + Intronic
903873481 1:26454954-26454976 CCAGCCCCACTGCTTGGCCTGGG + Intronic
904295715 1:29518518-29518540 CAATCCCCACTACTCTGACTGGG - Intergenic
905650482 1:39653164-39653186 CTACCCCTACTCCTGAGCCTTGG - Intergenic
906694346 1:47814143-47814165 CAGCCCCCATTCCTCTGCATGGG - Intronic
907332609 1:53681079-53681101 CAGGCCCCTCTTCTCGGCCTTGG + Intronic
907475230 1:54701025-54701047 CAATCCCCACTTCCAGGCCTTGG - Intronic
910746981 1:90584458-90584480 CAAGCCCCAGTCCTCTACCTGGG + Intergenic
913175368 1:116268213-116268235 CAAACCCTCCTCCTCAGCCTTGG + Intergenic
913213414 1:116600244-116600266 CAAACCCCACTACCCTGCCTGGG - Exonic
915165703 1:153946668-153946690 CTACCCCCACCCCTCCTCCTCGG + Exonic
915386378 1:155497411-155497433 CAACCCCTACTCTTCCTCCTTGG + Intronic
919897531 1:202018503-202018525 CCACCCCCACTCCCCAGCCCAGG - Intergenic
920260619 1:204685544-204685566 CCACCCCCTCTCCGCGCCCTGGG + Intronic
920330287 1:205202402-205202424 CCAGCCCCACTGCTTGGCCTGGG - Intronic
921969007 1:221124234-221124256 CAACTCCCACTCCTCAGCTGTGG - Intergenic
922290212 1:224203534-224203556 CAAGCAGAACTCCTCGGCCTGGG + Intergenic
922757140 1:228102815-228102837 CGACCCCCAGTCCCCGGCCCCGG + Intronic
923400879 1:233614573-233614595 CAACCCACACACCCCGGCCCCGG + Intronic
923562382 1:235051029-235051051 CAAGCCCCACTCCTGGGCTGAGG + Intergenic
1063663655 10:8049724-8049746 CACCGCCCCCTCCTCCGCCTCGG - Intergenic
1063904820 10:10770657-10770679 CACCCCCCACTCCTCACCCCAGG + Intergenic
1067047778 10:42995074-42995096 CATCCCCCACCCCTAGCCCTTGG - Intergenic
1067102492 10:43343096-43343118 CTACCCCCACCCCTTGTCCTGGG + Intergenic
1069641949 10:69961977-69961999 CAACCACAACTCCCCAGCCTTGG - Intronic
1070756126 10:78994242-78994264 CTACCCCCACTCCCCAGGCTGGG - Intergenic
1073179264 10:101574100-101574122 CAGCCCCCTCTGCTGGGCCTTGG - Intronic
1073354091 10:102840200-102840222 CCACCGCCACTCCTCCCCCTCGG - Intergenic
1075129668 10:119726636-119726658 GGACCCCCTCCCCTCGGCCTGGG - Intronic
1075651524 10:124130670-124130692 CAACTCCCACTCCTGTGCCCAGG + Intergenic
1075747558 10:124738229-124738251 CAGCCCTCACTCCTCAGTCTTGG + Intronic
1076721763 10:132396300-132396322 CACCTCCCACTCCTCGCCCGCGG + Intergenic
1076852870 10:133101634-133101656 CAGCCCCCACAGCCCGGCCTCGG - Intronic
1077338240 11:2014842-2014864 CAAGGCCCACCCCTGGGCCTAGG - Intergenic
1077374557 11:2199463-2199485 CATCCTCCCCTCCTCAGCCTGGG + Intergenic
1077491109 11:2861494-2861516 CAACCCCCACTGGTCCACCTGGG + Intergenic
1078408809 11:11094571-11094593 CAACTCCCACACCTTGGTCTTGG - Intergenic
1079104100 11:17559445-17559467 CCATCCTCACTCCACGGCCTGGG + Intronic
1083479323 11:62933657-62933679 AACCCCCCACCTCTCGGCCTTGG - Intergenic
1083678879 11:64342323-64342345 CAAACCCTGCACCTCGGCCTGGG - Exonic
1084932360 11:72567118-72567140 CATCCCCCACTCCTCGTCCGTGG - Intergenic
1085398313 11:76218971-76218993 CCACCCCCATACCTCAGCCTCGG - Intergenic
1085680727 11:78572510-78572532 CATCCCCAGCTCCTCTGCCTAGG + Intronic
1088758514 11:112907311-112907333 CAAACCCCTCGCCTGGGCCTGGG - Intergenic
1089615692 11:119693501-119693523 CACCTTCCACTCCTGGGCCTTGG - Intronic
1090339982 11:126009310-126009332 CAACCATCACTCCTCTGCCAAGG + Intronic
1202821224 11_KI270721v1_random:70024-70046 CAAGGCCCACCCCTGGGCCTAGG - Intergenic
1091716801 12:2783495-2783517 CAGCCCCGACTCCCCTGCCTGGG + Intergenic
1091794854 12:3292224-3292246 CCACCCCCACCCCTCTGTCTGGG + Intergenic
1093561901 12:20552194-20552216 CGACCGCCAGTCCTTGGCCTCGG - Intronic
1094423410 12:30295744-30295766 CAACTCCCACTCCACTGCCGTGG - Intergenic
1095851531 12:46813475-46813497 CAATCCCCACTCTGCTGCCTAGG + Intronic
1096407712 12:51355812-51355834 CAATTCCCATTCCTCGTCCTTGG + Exonic
1101302404 12:103495644-103495666 CAACCCCCACCTCGCCGCCTCGG - Intronic
1104536367 12:129621561-129621583 CTCTCCCCACTCCTCTGCCTTGG + Intronic
1104607363 12:130199876-130199898 CATCCCACCCTCCCCGGCCTGGG - Intergenic
1104726998 12:131084380-131084402 CAACCCCCACACCACGGTCTGGG + Intronic
1104910120 12:132236285-132236307 CGACCCCCACTCCAGGGCCATGG - Intronic
1104928999 12:132328630-132328652 CACCCCACACTCCTGGACCTAGG + Intronic
1105844299 13:24281340-24281362 CCACCTCCACTCCCCTGCCTGGG - Intronic
1106479906 13:30129585-30129607 CATGCCCCTCTCCTCCGCCTTGG + Intergenic
1110081602 13:71320782-71320804 CAAACCCCACACCTAGGCCCTGG - Intergenic
1118778376 14:68988896-68988918 CGCCCCCCACACCTTGGCCTTGG + Intergenic
1119320526 14:73727419-73727441 CCACCCACACCCCTCGGCCAGGG + Intronic
1120148076 14:81001568-81001590 CCAGCCCCACTGCTTGGCCTGGG + Intronic
1121263089 14:92580785-92580807 ACACACCCACTCCTAGGCCTTGG - Intronic
1122659196 14:103283139-103283161 CCAGCCCCACTGCTTGGCCTGGG - Intergenic
1122773966 14:104109058-104109080 CATCCCCCCATCCTCTGCCTAGG - Intronic
1122900012 14:104778529-104778551 CAACCCCAGCCCCTCAGCCTGGG + Intronic
1124404171 15:29379449-29379471 GAACCCCTTCTCCTCTGCCTGGG + Intronic
1124607136 15:31178169-31178191 CCTCCCCCACTCCCCGCCCTGGG + Intergenic
1127921491 15:63497889-63497911 CCACCCCCACTCACCAGCCTGGG + Intergenic
1128735054 15:70048829-70048851 CAACCCCCACTGCTCTGCCCAGG + Exonic
1132647156 16:1004375-1004397 CCAGCCCCACTCCTGGGCCTGGG + Intergenic
1132765077 16:1530477-1530499 CCAGCCCCACACCTGGGCCTCGG - Intronic
1134676508 16:16094358-16094380 CCAGCCCCACTTCTTGGCCTGGG + Intronic
1136153457 16:28366915-28366937 CAATCCTCCCGCCTCGGCCTGGG - Intergenic
1136209629 16:28748352-28748374 CAATCCTCCCGCCTCGGCCTGGG + Intergenic
1136394437 16:29985460-29985482 GAACTTCCGCTCCTCGGCCTGGG - Exonic
1138971622 16:62151245-62151267 CAGCCCCCACTCCCCGCCCCCGG + Intergenic
1139890942 16:70252989-70253011 CATCACCCACTCCTTGCCCTGGG + Intronic
1140311784 16:73856421-73856443 CAACCCCCACCCCTTGGCAAGGG + Intergenic
1143277495 17:5722562-5722584 CCACCCCCACACCACTGCCTTGG + Intergenic
1143559853 17:7687121-7687143 AAAGCTCCACTCCTCTGCCTAGG + Exonic
1143598984 17:7931864-7931886 CCGCCCCCACTCCTTGGGCTCGG + Exonic
1145005505 17:19335547-19335569 CACCCCCCACCCCACGCCCTCGG - Exonic
1145816441 17:27798365-27798387 CCACCCCCACCCCTCCGCCATGG + Intronic
1145911749 17:28547201-28547223 CAACCCCAAGTCCTCTGCTTGGG - Exonic
1146884848 17:36464086-36464108 CAGCCGCCACTCCCCAGCCTGGG - Intergenic
1146930280 17:36771966-36771988 CACCACCCACTCCCCGCCCTGGG - Intergenic
1147938021 17:44024693-44024715 CAGGCCTCACTCCTCCGCCTGGG + Intergenic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1148745816 17:49917518-49917540 CAAGCCACCCACCTCGGCCTCGG + Intergenic
1150241872 17:63640944-63640966 CACCCCCCACTCCACTGCCTGGG + Intronic
1152205730 17:78973542-78973564 GAGCCCCCACTCCCCAGCCTTGG + Intronic
1152575307 17:81137385-81137407 GAACCCCCCCTCCTCTGCCCAGG - Intronic
1156727272 18:40144249-40144271 CCAGCCCCACTGCTTGGCCTGGG + Intergenic
1158942270 18:62415887-62415909 CCAGCCCCACTGCTTGGCCTGGG - Intergenic
1160422559 18:78757155-78757177 GAACCCGCCCTCCTGGGCCTGGG + Intergenic
1160909123 19:1466697-1466719 CCACCCCCAGGCCCCGGCCTCGG - Exonic
1161346339 19:3770535-3770557 CAGCCACCACGCCTTGGCCTAGG - Exonic
1161557204 19:4950658-4950680 CGACCGCCAGTCCTTGGCCTCGG - Exonic
1161806955 19:6449931-6449953 CAACCCCCATGCCCCGCCCTGGG + Intronic
1161979401 19:7622728-7622750 CAGCCCCCACCCCACAGCCTGGG + Intronic
1162102284 19:8346726-8346748 CCAGCCCCACTGCTTGGCCTGGG - Intronic
1162399481 19:10436116-10436138 CACCTCCAACTCCCCGGCCTAGG - Intronic
1163335958 19:16671817-16671839 CTACCCCCACTCCCCAACCTCGG + Intronic
1163574562 19:18103051-18103073 CAACCTCCACTCCTCTGGGTGGG + Intronic
1165893917 19:39130307-39130329 CAGCCCCAACCCCTCTGCCTGGG - Intronic
1165906920 19:39199972-39199994 CAGCCCCAACCCCTCTGCCTGGG + Intronic
1166069085 19:40377196-40377218 CAGCCCTCACCCCTCTGCCTGGG - Intronic
1167134864 19:47610017-47610039 CATCTCCTACCCCTCGGCCTGGG + Intronic
1167740290 19:51320486-51320508 CAGCCCCCACTCCCTGGCCCTGG + Intronic
1168289942 19:55352719-55352741 CAAGCGGCACTCCTTGGCCTGGG + Exonic
925869124 2:8253957-8253979 CACCCCCCACCCCCAGGCCTGGG + Intergenic
926335428 2:11859146-11859168 CACCTCCCACTCCACAGCCTTGG - Intergenic
928364683 2:30691889-30691911 CAGCCCCCACTCAGAGGCCTTGG + Intergenic
928930484 2:36619069-36619091 CAACCCCCAGACCACGGACTGGG + Intronic
929607553 2:43245009-43245031 CAGCCTCCTCTCCTCTGCCTGGG + Intronic
932492742 2:72132178-72132200 CAACCACCACCCCGCTGCCTGGG + Exonic
940945679 2:159615551-159615573 CCACCCCCACTCCCCGGCTTGGG - Intronic
946633239 2:221694820-221694842 CAACCCCCACTGCTGGTCCCAGG - Intergenic
947329493 2:229013722-229013744 AAATCCCCACTCCTCGACTTTGG - Intronic
947715146 2:232335564-232335586 CAGCCCCCACCCCTGGCCCTTGG + Intronic
947734221 2:232446515-232446537 CAGCCCCCACCCCTGGCCCTTGG + Intergenic
947901015 2:233721842-233721864 CCAGCCCCACTGCTCGGCCCTGG + Intronic
948468103 2:238161814-238161836 CACCCCTCACGCCTCGGCCTGGG + Intronic
949036129 2:241816506-241816528 CAGCCTCCACTCCTCGGTCCTGG + Exonic
1170562765 20:17570567-17570589 CGCCCCCCACTCCCCGGCCTCGG - Intronic
1170704898 20:18736600-18736622 CCACCCCCTCTCCTTGCCCTGGG + Intronic
1172681697 20:36720849-36720871 CAACCTCCACTCCACCTCCTGGG + Intronic
1172978672 20:38925197-38925219 CAACCCCAACCCCTCTGCCTGGG - Intergenic
1174310080 20:49645944-49645966 CAACCCTCCCACCTAGGCCTGGG - Intronic
1176310381 21:5146031-5146053 TACCTCCCACTCCTCGGCCCTGG + Intronic
1179846674 21:44116004-44116026 TACCTCCCACTCCTCGGCCCTGG - Intronic
1179995012 21:44970144-44970166 CAACCCCCACCCCGAGGCCAGGG - Intronic
1180836476 22:18932165-18932187 CAAGCCCCACTCCTGGATCTGGG - Intronic
1181014739 22:20062422-20062444 CATCTCCCACTCCTCCCCCTGGG + Intronic
1181546081 22:23603403-23603425 CTACCCCCACTCTCCGCCCTGGG + Intergenic
1184347817 22:43924146-43924168 GATCCCCCGCTCCCCGGCCTAGG - Intronic
1203286568 22_KI270734v1_random:157464-157486 CAAGCCCCACTCCTGGATCTGGG - Intergenic
950080145 3:10216129-10216151 CATTCCCCTCTCCTCTGCCTTGG - Intronic
951239209 3:20270430-20270452 CAACCCCGACTCTTCGGAATTGG + Intergenic
952889580 3:38031094-38031116 CAAGCCCCCCTCCTCTTCCTAGG + Intergenic
953930229 3:47002306-47002328 CAGCCCCCACTCCTCTTCCTGGG - Intronic
954067835 3:48120982-48121004 CCAGCCCCACTGCTTGGCCTGGG + Intergenic
954300693 3:49699380-49699402 CACCCCCCACCCCGGGGCCTGGG - Intronic
956778462 3:72586085-72586107 CCACCCCCACTCCCCAGGCTGGG - Intergenic
957630165 3:82707614-82707636 GAGCCCCCACTCCTCAGCCAAGG - Intergenic
961815089 3:129545592-129545614 CCACCCCCACTCCCCAGCCCTGG + Intronic
962745497 3:138394875-138394897 CAGCACCCACTCCCCGCCCTCGG + Intronic
964971976 3:162575203-162575225 CAACCCCGACTCTTCGGAGTTGG + Intergenic
967256104 3:187593581-187593603 CAACCACAACTCCTCTGCCAAGG + Intergenic
968702061 4:2061954-2061976 CCACCCCCGCGCCACGGCCTTGG + Intronic
968779643 4:2570773-2570795 CAGGCCCCACTCCCCGGCCTGGG + Intronic
968912358 4:3482789-3482811 AGACCCCCAGTGCTCGGCCTTGG - Intronic
969584585 4:8084554-8084576 AAAGCCCCATTCCTGGGCCTGGG + Intronic
969876817 4:10141531-10141553 CAACCCCCACCCCTCCCCCAGGG - Intergenic
970109587 4:12622871-12622893 CAATCCTCTCTCCTCAGCCTGGG + Intergenic
975477934 4:74844335-74844357 CCACCCCCACTCCTGGTCCGTGG + Intergenic
976269061 4:83212418-83212440 CCACACCCACACCTCAGCCTAGG - Intergenic
980930398 4:139177880-139177902 CAGTTCCCACTCCTCAGCCTTGG + Intergenic
985777848 5:1854273-1854295 CAACCCTCCCACCTCAGCCTTGG - Intergenic
990473220 5:56137188-56137210 CCAGCCCCACTGCTTGGCCTGGG - Intronic
991216838 5:64165763-64165785 CAGCCCCGACCCCGCGGCCTCGG - Intergenic
993828971 5:92729511-92729533 CCACCCCCACCCCATGGCCTTGG + Intergenic
995496299 5:112748101-112748123 CAACCCCCGCTCCTGGTCGTTGG + Intronic
997431621 5:133844898-133844920 CAACCCCCACGCCATAGCCTTGG + Intergenic
998130912 5:139650612-139650634 CGCCCCCCACCCCGCGGCCTGGG - Intronic
999305660 5:150517941-150517963 CCAGCCCCACCCCTTGGCCTAGG - Intronic
1001009652 5:168086206-168086228 CAGCCCCCGCTCCACGGTCTAGG + Intronic
1001470049 5:172005963-172005985 CAGCACCCACTCCCCAGCCTAGG - Intronic
1003864569 6:10351278-10351300 CAATCCTCCCGCCTCGGCCTGGG - Intergenic
1004741647 6:18467421-18467443 CAACCCCCACTCCATAGCCCTGG - Exonic
1004929411 6:20447411-20447433 CCACCCCCACCCCTCAGCATAGG + Intronic
1006188214 6:32192194-32192216 CAAACTCCACCACTCGGCCTTGG - Exonic
1006362150 6:33592724-33592746 CAACCTCCACTCCTGGGCTCAGG + Intergenic
1006491377 6:34391748-34391770 CCACCCCCACCCCTCAGCTTTGG + Intronic
1007607163 6:43125378-43125400 CAGCACCCACTCCTGGGGCTGGG - Intronic
1008088371 6:47267929-47267951 CAACCCCCACTCCTCATCATGGG + Intronic
1010817342 6:80374336-80374358 CTAGCCCCACTGCTTGGCCTGGG + Intergenic
1010980136 6:82362975-82362997 CAATCCCCACTCCTCATCCTTGG + Intergenic
1011799745 6:90998961-90998983 CAACCTCCACTCCACCTCCTGGG + Intergenic
1013290661 6:108716655-108716677 CAGCCCCCACGACTCTGCCTGGG - Intergenic
1018730882 6:166649646-166649668 CAACCCCCACTCCCAGGGCAAGG + Intronic
1019943214 7:4307537-4307559 CAACCCCCTCTCTCCGGCCAAGG + Intergenic
1019984739 7:4647463-4647485 CAACTCCATCTCCACGGCCTTGG + Intergenic
1027722465 7:81761781-81761803 CCACCCCCACTCCACACCCTTGG - Intronic
1029207414 7:98878179-98878201 CCACCCCCACTCCTCGCTCCCGG - Intronic
1029495530 7:100894139-100894161 CAGCCCCCACTCCTCCACCCAGG + Exonic
1033123760 7:138689191-138689213 CCAGCCCCACTGCTTGGCCTGGG - Intronic
1034273015 7:149812355-149812377 CAGCCCCCACCCCAGGGCCTGGG + Intergenic
1035382480 7:158448614-158448636 CAGCTCCCACTCCTGGGCCAAGG + Intronic
1035662052 8:1355795-1355817 CAACCCCCACCCCACGGTCCTGG + Intergenic
1036068736 8:5415858-5415880 CAATCCCCACTCCCCGCCCTCGG + Intergenic
1038677019 8:29632302-29632324 CCAGCCCCACTGCTTGGCCTAGG - Intergenic
1040363964 8:46694932-46694954 CAACCCTCACTCCTCAGCCCTGG - Intergenic
1042224929 8:66508024-66508046 CAGTCCCCAGTCCTGGGCCTGGG + Intronic
1046606777 8:116380458-116380480 CAACCCCCACTCCCTGGAGTAGG + Intergenic
1047494794 8:125401906-125401928 CAAACCCCTCTCCTCTACCTGGG + Intergenic
1048576099 8:135690893-135690915 CAGCCCTCTCTCCTCTGCCTGGG - Intergenic
1048755469 8:137733261-137733283 CCTCCCCCAGTCCTCTGCCTGGG - Intergenic
1049435367 8:142583892-142583914 CCACCCCCACTCCACGCCCATGG - Intergenic
1049554018 8:143273435-143273457 CTCCCCTCACTCCTCAGCCTGGG + Intronic
1049651835 8:143773383-143773405 CCCACCCCACTCCTGGGCCTGGG - Intergenic
1049709824 8:144058453-144058475 CACTGCCCACTCCTGGGCCTGGG - Intronic
1049758060 8:144319536-144319558 CAACTCCCCCTCTTCAGCCTTGG - Intronic
1053200533 9:36148916-36148938 CAACCCCCACTCCTCGGCCTGGG - Intronic
1053451018 9:38194016-38194038 CCACCCACACTCCTTGGCTTGGG - Intergenic
1056720186 9:89064632-89064654 CATCCCCCACGCCACTGCCTGGG - Intronic
1057042102 9:91855463-91855485 CACCCCTCCCTTCTCGGCCTGGG - Intronic
1058216055 9:102235212-102235234 CAATCCGCCTTCCTCGGCCTCGG - Intergenic
1060182745 9:121545617-121545639 AAACGCCCACTCCTCGGCGGTGG - Intergenic
1060415010 9:123424016-123424038 CCACCCCCTCTCCCCAGCCTAGG - Intronic
1060703367 9:125779076-125779098 CATCCCCCACCCCTAGCCCTTGG + Intronic
1062399624 9:136366674-136366696 CAACCCCCACTCCACAGACAGGG - Intronic
1186247766 X:7632096-7632118 CCAGGCCCACTCCTGGGCCTTGG - Intergenic
1186689973 X:11964917-11964939 CAACCCACATTCCTTGGCTTGGG + Intergenic
1189325685 X:40109495-40109517 CGACCTCCGCTCCTCGGCCCCGG + Intronic
1189348184 X:40258369-40258391 TGAGCCCCACTCCTCTGCCTGGG + Intergenic
1189462143 X:41251494-41251516 CAATCCACCCACCTCGGCCTCGG - Intergenic
1190176542 X:48155399-48155421 CAATCCTCCCGCCTCGGCCTCGG - Intergenic
1190181753 X:48198173-48198195 CAATCCTCCCGCCTCGGCCTCGG + Intronic
1190667526 X:52708655-52708677 CAATCCTCCCGCCTCGGCCTCGG + Intergenic
1190671892 X:52749753-52749775 CAATCCTCCCGCCTCGGCCTCGG - Intergenic
1192174411 X:68876853-68876875 CAACCCCCACTCCCAGTCCCAGG - Intergenic
1196002036 X:110796197-110796219 CAGCCCCCACTCCTTTGGCTAGG + Intergenic
1198388098 X:136147551-136147573 CCACCGCCGCGCCTCGGCCTCGG + Exonic
1200093879 X:153648237-153648259 GGCCTCCCACTCCTCGGCCTCGG - Exonic
1202257562 Y:22937815-22937837 CAACCCCAACTCTTCGGAGTTGG + Intergenic
1202410552 Y:24571562-24571584 CAACCCCAACTCTTCGGAGTTGG + Intergenic
1202460229 Y:25098510-25098532 CAACCCCAACTCTTCGGAGTTGG - Intergenic