ID: 1053203817

View in Genome Browser
Species Human (GRCh38)
Location 9:36170267-36170289
Sequence TGTCCTGATGGACCGCAAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053203814_1053203817 -10 Left 1053203814 9:36170254-36170276 CCCTGATTGAGAGTGTCCTGATG 0: 1
1: 0
2: 9
3: 510
4: 7369
Right 1053203817 9:36170267-36170289 TGTCCTGATGGACCGCAAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1053203812_1053203817 -1 Left 1053203812 9:36170245-36170267 CCCATACAACCCTGATTGAGAGT 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1053203817 9:36170267-36170289 TGTCCTGATGGACCGCAAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1053203813_1053203817 -2 Left 1053203813 9:36170246-36170268 CCATACAACCCTGATTGAGAGTG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1053203817 9:36170267-36170289 TGTCCTGATGGACCGCAAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1053203811_1053203817 5 Left 1053203811 9:36170239-36170261 CCTCATCCCATACAACCCTGATT 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1053203817 9:36170267-36170289 TGTCCTGATGGACCGCAAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053203817 Original CRISPR TGTCCTGATGGACCGCAAGC AGG Exonic
904629310 1:31829427-31829449 TGTCCTGCTGGACCTCAGCCAGG - Intergenic
907648129 1:56264679-56264701 TGCCCAGATGGCCCACAAGCTGG - Intergenic
915249881 1:154580353-154580375 TGCCCTGAGGGAGCGCAAGAGGG - Intergenic
922727488 1:227929535-227929557 TGTCCTTACGGACCCCAGGCTGG + Intronic
1073464160 10:103684154-103684176 TGTCCTGAAGCACAGGAAGCCGG - Intronic
1083257584 11:61506111-61506133 TGTGCTGATGGAGCCCAAGAGGG + Intergenic
1083330382 11:61895498-61895520 TGTCCTGATGGAACTCCTGCCGG - Intergenic
1097780970 12:63704073-63704095 TGTGCTGATGGATGGCATGCCGG - Intergenic
1102021462 12:109686403-109686425 TGTGCTGATGGACCCCATGTGGG + Intergenic
1105762330 13:23526254-23526276 TGTCCTCCTGGACCACAAGGGGG - Intergenic
1111638256 13:90932901-90932923 TGTTCTGATTGACGGCAATCGGG - Intergenic
1132173474 15:99688213-99688235 TCTGCTGTTGGACTGCAAGCTGG + Intronic
1137445257 16:48527529-48527551 AGTCCTGATGGGCCTCAACCAGG + Intergenic
1139194559 16:64904167-64904189 TGTCCTGATGTACTGCAGGTTGG - Intergenic
1140030558 16:71334911-71334933 TGGCCTGGTGGAAGGCAAGCTGG - Intergenic
1142174355 16:88638426-88638448 TGTCCTGATGCACAGCAGGCGGG + Intergenic
1142402729 16:89869357-89869379 TGTCCAGATGTGCAGCAAGCAGG + Intronic
1148796953 17:50201662-50201684 TGTCCTGATGGAGAGCAGGGAGG + Intergenic
1154285552 18:13053072-13053094 TGCCCTGGAGGACCGCAAGGTGG + Exonic
1156744161 18:40369170-40369192 TGTTCTGTTGGACTGAAAGCTGG - Intergenic
1162760794 19:12887102-12887124 TGTGCTGATGGAGGGCAAGGCGG + Exonic
1162835996 19:13318413-13318435 TGGCCTGGTGGACCACAAGGAGG + Intronic
927864505 2:26580085-26580107 TCTCCACATGGACCACAAGCAGG - Intergenic
937252871 2:120535173-120535195 TGTCCTGGTGGACCCCCAGTGGG - Intergenic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG + Intronic
1185228511 22:49667533-49667555 TGTCCTGCAGGACCCCAGGCTGG - Intergenic
950392620 3:12708572-12708594 TGTTCTCATGGGCAGCAAGCGGG - Intergenic
952452862 3:33448044-33448066 TGTCCTCCTGGACCACAAGGAGG - Intergenic
953967361 3:47319730-47319752 TGACATGATGGAGTGCAAGCAGG + Exonic
954801309 3:53188711-53188733 TGTCCTTAGGGACCTCAAACTGG + Exonic
956404896 3:68917870-68917892 TGTCCTGATCGTCCACAAACTGG - Intronic
967013418 3:185460212-185460234 TGTTCTGATGGACAGCAGTCAGG - Intronic
973007088 4:45022728-45022750 TATGCTTATGGACAGCAAGCAGG - Intergenic
974831907 4:67200041-67200063 TGTCCTGATGGCCCTAAGGCTGG - Intergenic
983625250 4:169795863-169795885 TGGCCTGTTGGACAGCAGGCAGG + Intergenic
988473152 5:31559251-31559273 TGTCCTGTAGGAACGCAAGCTGG - Intergenic
990719593 5:58678996-58679018 TGAGCTGATGGACTGTAAGCTGG + Intronic
990862163 5:60338960-60338982 TGTTCTGATTGACCGCAATTAGG - Intronic
991127897 5:63088237-63088259 TGTCCTGATGGTGAGGAAGCTGG - Intergenic
992476039 5:77102598-77102620 TGTCCTTCTGGAACCCAAGCTGG - Intergenic
993363416 5:87005424-87005446 GCTCCTGATGGACAGCCAGCTGG + Intergenic
998367524 5:141640681-141640703 TGTGCTGATGGACTACCAGCTGG + Exonic
1006744567 6:36332175-36332197 GGGCCTGAAGGACAGCAAGCAGG - Intronic
1010242691 6:73631132-73631154 TGTCCTGTTGAACCGAAACCAGG + Intronic
1018853562 6:167659021-167659043 TGTCCTGATAGACAGCAAGTGGG + Intergenic
1019606775 7:1913953-1913975 TGTCCTGCTGGACGCCATGCTGG + Intronic
1019837397 7:3402050-3402072 TGTCCTCATGGAACTCAATCTGG + Intronic
1020379004 7:7521447-7521469 TGGCCTCATGGACAGGAAGCTGG - Intronic
1022939552 7:35220133-35220155 TGTGCTGATGGATGGCATGCCGG - Intronic
1034911097 7:154999540-154999562 TGTCCTGATGGGCAGAAAGGAGG + Intronic
1035010218 7:155709005-155709027 TGTCCTGTTGGACCGCACTCTGG + Intronic
1038339285 8:26670845-26670867 TCTCCTCATGGACCGAATGCAGG - Intergenic
1053203817 9:36170267-36170289 TGTCCTGATGGACCGCAAGCAGG + Exonic
1055127331 9:72733633-72733655 TGTTCTGATTGACAGCAATCAGG - Intronic
1059163908 9:112060814-112060836 TGTACTTATGGACCGCATGGAGG - Intronic
1061300050 9:129698945-129698967 TATCCTGATGGCCCTCCAGCTGG - Intronic
1061958131 9:133974191-133974213 TGTCCTCCTGGGCCGCAAGCAGG + Intronic
1189242497 X:39536443-39536465 TGTGCTGATGGAGGGGAAGCGGG - Intergenic
1192590786 X:72357750-72357772 TGTTCTGATTGACAGCAATCAGG - Intronic
1193779834 X:85687757-85687779 TGACCTGATGGCCTTCAAGCTGG + Intergenic