ID: 1053207648

View in Genome Browser
Species Human (GRCh38)
Location 9:36200471-36200493
Sequence CTAGTTCAACAGTTCCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053207648_1053207652 30 Left 1053207648 9:36200471-36200493 CCTCTTGGGAACTGTTGAACTAG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1053207652 9:36200524-36200546 GATAACTGACACCCAGAAATAGG No data
1053207648_1053207649 7 Left 1053207648 9:36200471-36200493 CCTCTTGGGAACTGTTGAACTAG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1053207649 9:36200501-36200523 ATGAGTCCTTATTTTTCAGATGG No data
1053207648_1053207650 8 Left 1053207648 9:36200471-36200493 CCTCTTGGGAACTGTTGAACTAG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1053207650 9:36200502-36200524 TGAGTCCTTATTTTTCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053207648 Original CRISPR CTAGTTCAACAGTTCCCAAG AGG (reversed) Intronic
907395507 1:54186967-54186989 CTAGATCATCATTTCCCAAATGG - Intronic
913505450 1:119512674-119512696 CTACTTCAACAGCTCCCAAAAGG + Intronic
915049124 1:153049292-153049314 CAGGTCCAACAGTTCCCCAGGGG - Intergenic
917601348 1:176577443-176577465 CTAGTGAAACAGTCCCCAGGAGG + Intronic
917873316 1:179261796-179261818 CTAGGTTAACATTTCCCAAAAGG - Intergenic
918685112 1:187404880-187404902 CTAGCTCAACATTCCCAAAGTGG + Intergenic
924144471 1:241059804-241059826 CAAGTTCAACAGGTCCAAAATGG + Intronic
1063699616 10:8371744-8371766 CTAGTTCCTCATTTCCCAGGTGG - Intergenic
1071727424 10:88213480-88213502 CTTGTTCAACATTTAGCAAGTGG + Intergenic
1072158951 10:92748607-92748629 CAAGATCAAGTGTTCCCAAGAGG - Intergenic
1072884924 10:99264622-99264644 CTAATTAGACAGTGCCCAAGGGG - Intergenic
1075345171 10:121676610-121676632 TGAGTTGGACAGTTCCCAAGAGG + Intergenic
1078330523 11:10415480-10415502 CTTGTTCTACATTTGCCAAGTGG + Intronic
1079828960 11:25236800-25236822 CTAGTTTAAAAGTGCTCAAGTGG - Intergenic
1080372265 11:31665086-31665108 TGAGTTCAAGATTTCCCAAGCGG + Intronic
1081299696 11:41435708-41435730 GTAGGTCATCATTTCCCAAGTGG + Intronic
1084336912 11:68463785-68463807 CTAGTTCAAGAGTTCTCAGTTGG + Intronic
1086264023 11:84976316-84976338 CTAATTAAACAGTTGCCAGGGGG + Intronic
1090006115 11:123003691-123003713 CTAGATCCAGAGTTCCCAAATGG + Intergenic
1102838684 12:116094142-116094164 CTATTTCAACATCTACCAAGAGG + Intronic
1108209135 13:48120756-48120778 CTAGGTCAAAAGTTGCCAGGAGG + Intergenic
1111459918 13:88525562-88525584 CTAGTTCTCCAGTTCATAAGAGG + Intergenic
1113058970 13:106300528-106300550 CTAGATCCACAGTTCCCAATAGG - Intergenic
1113436304 13:110294182-110294204 CTAGTTCCACAGGACCCGAGTGG - Intronic
1117724116 14:58655617-58655639 CTAGTTCTAAAGTTTCCAAACGG + Intergenic
1120191917 14:81447290-81447312 CTAGTTCCATAGTTACTAAGTGG + Intergenic
1121702085 14:95962307-95962329 CTAGTTTCAAAGTTCCCATGAGG - Intergenic
1121774587 14:96582424-96582446 CAAGTCCCAGAGTTCCCAAGAGG - Intergenic
1126960021 15:53981792-53981814 CTAGGTCAAAAGTCCCCCAGAGG + Intergenic
1128326764 15:66729096-66729118 CTTGGTCCCCAGTTCCCAAGTGG + Intronic
1142295728 16:89220709-89220731 CTGGTTCACCACTTCCTAAGTGG + Intronic
1150513630 17:65783857-65783879 CTATTTCAACTGTTGCCAGGTGG + Intronic
1156348541 18:36282328-36282350 TAATTTCAACAGTTCCCATGAGG + Intergenic
1156697927 18:39790047-39790069 ATAGTTCAGCAGTCCCCAACTGG - Intergenic
1164534259 19:29073256-29073278 TGAGTTCAACAATTCACAAGGGG - Intergenic
929484317 2:42340698-42340720 CAAGTTCAACAGCGCCCCAGTGG + Intronic
929726326 2:44431826-44431848 CTAGTTCCCCATTTCCCAATGGG - Intronic
935728165 2:106042216-106042238 CTGGTTCAACAGAAGCCAAGTGG - Intergenic
937201799 2:120208853-120208875 CTTGTTCAACAATTCACCAGGGG - Intergenic
937500851 2:122477026-122477048 CATGTTCAACACTGCCCAAGGGG - Intergenic
940092560 2:149936995-149937017 CTATTGGAATAGTTCCCAAGAGG + Intergenic
940412862 2:153386646-153386668 TTAATTTAACAGTTTCCAAGCGG - Intergenic
943076954 2:183207338-183207360 CAAGTACAACAGTTCTAAAGTGG - Intergenic
944977774 2:205076675-205076697 CTAGATCCACAGTTCACAATAGG - Intronic
947279627 2:228436220-228436242 CTAGTTAAACAGTTCTCTACTGG + Intergenic
947931461 2:233968402-233968424 CTGGTTCTACAGTTTCCCAGAGG - Intronic
948205612 2:236161309-236161331 CTATTTGAACAGTTCAGAAGTGG - Intergenic
1169161267 20:3380611-3380633 CTAGTGCAGTAGTTCCCAACTGG - Intronic
1170116143 20:12862198-12862220 ATAGTTCTACAGCTCCCCAGAGG - Intergenic
1171134136 20:22681771-22681793 CTGGCTCATCAATTCCCAAGTGG + Intergenic
1172995458 20:39066942-39066964 CAAATTCAGCAGTTCCCGAGTGG + Intergenic
951630465 3:24714584-24714606 CTGTTTCCACAGTTCCCAAAGGG + Intergenic
953122455 3:40058206-40058228 CTCATTCACCAATTCCCAAGTGG - Intronic
955457943 3:59145217-59145239 ATAGTTCAACAGTCCTCCAGAGG - Intergenic
956452718 3:69390362-69390384 CTAGTTCAATGGTTCTCAACCGG + Intronic
960933741 3:122881851-122881873 TTAGTTCAAAACATCCCAAGTGG + Intergenic
965247557 3:166293066-166293088 TCAGCTCAACAGTTCCCAACTGG - Intergenic
967174848 3:186853636-186853658 CTAGATCAAGAGTTCCCCAAAGG - Intronic
971219126 4:24688840-24688862 ACAGTTCAACAGTGCACAAGGGG + Intergenic
975885479 4:78959508-78959530 CTAAATCAACAGTTCTCAACTGG + Intergenic
977912624 4:102555492-102555514 CTTGTTCAACAATTCCCACATGG - Intronic
980431833 4:132710340-132710362 ATAGTTCATCAGTTCGCTAGAGG - Intergenic
981119291 4:141030383-141030405 ACAGTTTGACAGTTCCCAAGAGG + Intronic
986368224 5:7055965-7055987 CTAATTAAAGAGTGCCCAAGGGG + Intergenic
987248797 5:16078623-16078645 CAAATCCAACAGTTCCCCAGAGG + Intronic
989240789 5:39201419-39201441 GTAGGTCAGCAGTTCCCAAAGGG - Intronic
990459956 5:56022197-56022219 CTAGTTCAGTAGTTTCCAAAAGG - Intergenic
991436526 5:66601861-66601883 CTATATCAACAGTTCCCAGCAGG - Intronic
993943559 5:94091983-94092005 ATAGTTCAACTGTTGCAAAGTGG - Intronic
994996770 5:107073771-107073793 CTAGTTCTACAGATCTCAACCGG - Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1000800415 5:165719749-165719771 CTTGCTCAGCTGTTCCCAAGGGG + Intergenic
1003451231 6:6234295-6234317 CTACATCAACAGTGACCAAGTGG + Intronic
1007999538 6:46344714-46344736 CTAGATGAAAAGTTCACAAGAGG + Intronic
1010029205 6:71255679-71255701 ATTGTCCAACAGTTGCCAAGGGG + Intergenic
1012272181 6:97226964-97226986 CTAGTTCAGTAGTTCTCAACTGG - Intronic
1015416617 6:132956277-132956299 CAAGTTCAACATTCCCCAAAAGG - Intergenic
1016233612 6:141835379-141835401 CAATTTCAACACTTGCCAAGAGG - Intergenic
1018395231 6:163373366-163373388 CAAGGTCAACAGTGCCCAAGCGG + Intergenic
1019963412 7:4480129-4480151 CTATTTCAACAATTTCAAAGTGG - Intergenic
1026405483 7:70061305-70061327 GTAGTTCCTCAGTCCCCAAGAGG + Intronic
1029624526 7:101712100-101712122 CTGGTTCAACTGATCCCAGGAGG - Intergenic
1031964507 7:128017986-128018008 CTACTTCAGCAGTTCCCCACTGG - Intronic
1032879984 7:136078424-136078446 CCAGTTCCCCAGTTCCCAAGGGG + Intergenic
1038428869 8:27483934-27483956 CTAGTTCATAACTTCCCAGGTGG - Intergenic
1039636274 8:39169518-39169540 AAAGTTCAACAGTTTCCAATAGG - Intronic
1041106639 8:54451019-54451041 CTAGTTCTACAGTTTACCAGTGG - Intergenic
1042490129 8:69387837-69387859 ATAGTTCAAGAGATACCAAGGGG + Intergenic
1053207648 9:36200471-36200493 CTAGTTCAACAGTTCCCAAGAGG - Intronic
1053282966 9:36833008-36833030 CTACTTCTTCAGTTCCCAAATGG - Intergenic
1055590943 9:77813257-77813279 ATAGTTCTACATTTCCCTAGTGG - Intronic
1057741566 9:97716377-97716399 CTAGTACAACAAACCCCAAGAGG + Intergenic
1059623902 9:116040226-116040248 CTGGGTTAACAGTTTCCAAGAGG + Intergenic
1187530185 X:20089404-20089426 CTAGTACAATATTTCCCAAATGG - Intronic
1188548426 X:31335936-31335958 CTAGCTCAAGAGCTCCCATGGGG - Intronic
1188568885 X:31558423-31558445 CTGATTCAACAGTTCTGAAGTGG + Intronic
1188638366 X:32465149-32465171 TTAGTCCAAAAGTTCCCAACTGG - Intronic
1189285066 X:39846299-39846321 AAAGGTCAACAGTGCCCAAGTGG - Intergenic
1192141448 X:68650120-68650142 CTAGCCCAACAGTTTCCAAGAGG - Intronic
1196596242 X:117548886-117548908 CAAGTTCACCAGTTCCCCATGGG - Intergenic
1197202554 X:123760641-123760663 CAAATTCAAAAGGTCCCAAGAGG - Intergenic
1197317702 X:124988436-124988458 CTAGTTCAAAAGTTCCCTTTTGG - Intergenic
1197805541 X:130395014-130395036 CTAGAGCAAGAGTTCCCAAATGG - Intergenic
1199243627 X:145576755-145576777 CCAGATCATCAGTTCCCTAGGGG - Intergenic