ID: 1053218738

View in Genome Browser
Species Human (GRCh38)
Location 9:36294009-36294031
Sequence AGGCTGCAGTCAGAACCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053218738_1053218739 -9 Left 1053218738 9:36294009-36294031 CCAGCAGGTTCTGACTGCAGCCT 0: 1
1: 0
2: 2
3: 36
4: 248
Right 1053218739 9:36294023-36294045 CTGCAGCCTCAGAAAGCCCCCGG No data
1053218738_1053218747 30 Left 1053218738 9:36294009-36294031 CCAGCAGGTTCTGACTGCAGCCT 0: 1
1: 0
2: 2
3: 36
4: 248
Right 1053218747 9:36294062-36294084 GCAGGCGCCCTGCAGAGTGAAGG No data
1053218738_1053218745 12 Left 1053218738 9:36294009-36294031 CCAGCAGGTTCTGACTGCAGCCT 0: 1
1: 0
2: 2
3: 36
4: 248
Right 1053218745 9:36294044-36294066 GGCTTTCCTGTTCAGCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053218738 Original CRISPR AGGCTGCAGTCAGAACCTGC TGG (reversed) Intronic
900348068 1:2220627-2220649 GGGCTGCAGTCAGAAGCCTCAGG + Intergenic
900971058 1:5992674-5992696 ATGCTGCTGGCGGAACCTGCAGG + Intronic
901274519 1:7980741-7980763 GGGCTGCAGTCATCACCTGGGGG + Intronic
902187411 1:14735629-14735651 AGGCTGCCGTGAGAAGCAGCAGG + Intronic
902392735 1:16115774-16115796 AGGCTGCAAGCAGAACCTGTGGG - Intergenic
902556259 1:17248664-17248686 AGGCTGCACCCCTAACCTGCTGG + Intergenic
902562721 1:17287805-17287827 AGGAAGCATTCAGTACCTGCTGG - Intergenic
903666450 1:25010562-25010584 TGGCTGCAGTGAGAGGCTGCAGG - Intergenic
905423064 1:37861293-37861315 AGAATGCAGGCAGAAGCTGCTGG - Intronic
905925235 1:41745035-41745057 AAGCTCCAGCCAGAACCTGGGGG + Intronic
905942496 1:41875126-41875148 AGGCAGCAGCCAGGACCTTCGGG - Intronic
907000188 1:50845231-50845253 AAGTTGCAGCCAGAAACTGCAGG - Intronic
907371015 1:54003619-54003641 AGCCTGCAGTGGCAACCTGCTGG - Intergenic
909434560 1:75625782-75625804 AGGCTGGAGTCAGAAACTACAGG - Intergenic
912384124 1:109262890-109262912 GGGCTGCATGCGGAACCTGCAGG + Exonic
912692274 1:111813252-111813274 AGGCTGGAATCAGAAATTGCTGG - Intronic
912970256 1:114274836-114274858 AGGCTGTAGTAAGGACCTGTGGG - Intergenic
915079938 1:153345221-153345243 AGTCTGCAGCCAGAGACTGCGGG - Exonic
915662377 1:157415004-157415026 AGGCTGCTGTCTGAACCGGCAGG - Intergenic
917811008 1:178658435-178658457 AGGCAGAGGTGAGAACCTGCAGG - Intergenic
918090338 1:181287769-181287791 AGGGTGCAGTCAAAACTTTCAGG - Intergenic
919448300 1:197738004-197738026 AGGAGGCAATCAAAACCTGCGGG - Intronic
920087107 1:203425526-203425548 AGGCTGCAGTAACCAGCTGCAGG + Intergenic
920335953 1:205245273-205245295 GAGCTGCAGTAAGAGCCTGCAGG + Intronic
920431272 1:205920838-205920860 TGGCTTCAGACAGAAGCTGCAGG + Intronic
920850965 1:209627564-209627586 ATGTTGCAGTCACAGCCTGCAGG + Exonic
921905909 1:220495399-220495421 ACCCTGCAGTCAGTACCTGAGGG - Intergenic
922293377 1:224227747-224227769 ATGCTGCAGTCCGCACCCGCAGG + Intronic
1063077644 10:2732879-2732901 AGTCTACATTCAGAGCCTGCTGG + Intergenic
1063126621 10:3141903-3141925 AGGCTGGAGTCAGACCCTGGGGG + Intronic
1063214037 10:3907766-3907788 AGGCTGCAGCCAGCAGCAGCTGG - Intergenic
1063395782 10:5685548-5685570 AGGCTTCACGCAGAACCCGCAGG - Intronic
1063593559 10:7412857-7412879 CGGCTCCAGGTAGAACCTGCTGG + Intergenic
1063974579 10:11405083-11405105 ATTCTGCAGTCAGAGCCTCCTGG - Intergenic
1064766235 10:18675623-18675645 AGTCTGCAGGCAGTACCTGATGG - Exonic
1064895382 10:20229382-20229404 AGGCTGCAAACACAACCTGATGG - Intronic
1066010363 10:31188697-31188719 AAGCAGCAGTCAGAAGCTTCTGG + Intergenic
1069355854 10:67584460-67584482 AGGTTTCAGTCAGACCCTCCTGG + Intronic
1069993108 10:72326775-72326797 AGCCAGCAGTGACAACCTGCTGG + Intergenic
1071439808 10:85680175-85680197 AGGCTGCAGGCAGACCCAGAAGG + Intronic
1071570731 10:86695414-86695436 AGGCTCCAGTGCCAACCTGCTGG + Intronic
1073143092 10:101261792-101261814 AGCCAGCAGCCAGCACCTGCAGG + Intergenic
1076132781 10:128025594-128025616 AGGCTGCATGGAGAAGCTGCAGG - Intronic
1076992563 11:283098-283120 AGGCTGCCGTTGGAAACTGCTGG + Intronic
1078606229 11:12778267-12778289 AGGCAGCAGTAAGAACATCCAGG - Intronic
1079360655 11:19767806-19767828 AGGATGCACTCAGACCCTGAGGG + Intronic
1082259573 11:50068057-50068079 AGGCTGCAGTCTCAAACTCCTGG + Intergenic
1084229954 11:67744370-67744392 AGGCAGCAGTCAGGGCCTGAGGG + Intergenic
1085868506 11:80323191-80323213 AGGGTGCAGGCAGAAACTGGAGG + Intergenic
1085955737 11:81392281-81392303 AGGCTGCAATCAAGAACTGCTGG + Intergenic
1087705027 11:101480363-101480385 AGACTGCAGTCACTACCTACCGG + Intronic
1090151582 11:124390109-124390131 AGGCTCCACTCAGAGACTGCTGG + Intergenic
1090807847 11:130213462-130213484 AGTCTGTAGCCAGGACCTGCTGG + Intergenic
1091201657 11:133785161-133785183 AGCCTGCTGTGAGACCCTGCGGG - Intergenic
1091491792 12:938834-938856 AGACTGCAGCCACAACCTCCTGG + Intronic
1092242872 12:6846168-6846190 AGGCTGCAGTCAGGGCCCTCGGG - Intronic
1092244370 12:6855311-6855333 AACCTGGAGTCAGAAACTGCTGG - Intronic
1097754422 12:63393524-63393546 AGGCTGCATTCAGAACTTGTAGG - Intergenic
1099135790 12:78898664-78898686 AGCCAGCTGGCAGAACCTGCTGG - Intronic
1099371737 12:81840439-81840461 TTGCTGCAGTCTCAACCTGCTGG + Intergenic
1099906931 12:88782555-88782577 AGGCTAGAGTCAGATCCTGAAGG - Intergenic
1104047919 12:125176250-125176272 AGGCAGCAGACAGAAACTCCAGG - Intergenic
1106241276 13:27915692-27915714 AGGCTGCAGCAGGAACCTGGAGG + Intergenic
1110546202 13:76758362-76758384 TGGCTCCAGACAGACCCTGCTGG - Intergenic
1113090269 13:106610639-106610661 GAGCTTCAGTCTGAACCTGCAGG - Intergenic
1113721698 13:112562375-112562397 AGGCTGGAGACAGCAGCTGCAGG + Intronic
1113822836 13:113227340-113227362 AGGATGCAGTGAGAAGGTGCTGG - Intronic
1113848773 13:113406421-113406443 AGACTCCAGACAGATCCTGCTGG - Intergenic
1114600646 14:23953493-23953515 AGGCAGCAGCCAAAGCCTGCGGG + Intergenic
1116769235 14:49108126-49108148 AGGTAGAAGTCAGAAACTGCTGG - Intergenic
1117965478 14:61203128-61203150 AGGCAGCAGTCAGTAACTGAAGG - Intronic
1118098493 14:62567510-62567532 AGGCTTTAGTCAGAGCCAGCAGG - Intergenic
1118597750 14:67449247-67449269 CGGCTGCAGTTAGCACCTCCTGG - Intronic
1122037602 14:98960223-98960245 GGGCTGCAGGCAGACCCTGGGGG - Intergenic
1122103896 14:99436450-99436472 AGGCTGCAGTGAGATGCTGGTGG - Intronic
1122864445 14:104597191-104597213 AGGCTGCAGCCAGAAACAGGAGG + Intronic
1123023645 14:105413527-105413549 AGGCTGCAGTCAGAGCGTGGTGG + Exonic
1123203652 14:106691902-106691924 ATGCGGCCCTCAGAACCTGCAGG - Intergenic
1123626870 15:22233096-22233118 AGGGTGGAGGAAGAACCTGCTGG + Intergenic
1125180387 15:36876443-36876465 AAACTGCAGGCAGAAACTGCAGG - Intergenic
1125744617 15:41989915-41989937 AAGCTGCAGACAGTGCCTGCCGG + Intronic
1126778899 15:52121249-52121271 CAGGTGCAGCCAGAACCTGCCGG + Exonic
1127230575 15:56989389-56989411 ATGCTGCAGACAGAATCTGTAGG - Intronic
1128347230 15:66862182-66862204 AGGGGGCAGTCAGCACCAGCTGG + Intergenic
1128611744 15:69079402-69079424 AGACTGCAGTTAGAGCCTGTGGG + Intergenic
1128620065 15:69141407-69141429 AGGCTGAAGGCTGAGCCTGCCGG + Intergenic
1129516283 15:76159539-76159561 AGGCTGCAGTGAGGACTGGCAGG - Intronic
1129918241 15:79294029-79294051 AGGCTCCAGTCTGAACCTTGGGG + Exonic
1129985748 15:79918554-79918576 AGGCTGCAGTGCGAGCCGGCTGG - Intronic
1130979936 15:88805266-88805288 AGGCTCCAGGGAGAAACTGCAGG + Intronic
1132032014 15:98446108-98446130 AGTCTGCAGGCAGTTCCTGCTGG - Intronic
1132859387 16:2062556-2062578 CGGCTGGATTCAGAACCTGCAGG + Exonic
1133203351 16:4218102-4218124 AGGCTGGAGTCAGGGACTGCAGG - Intronic
1133609782 16:7422624-7422646 AGGCTGCAGTCACAAACCCCTGG - Intronic
1135718678 16:24795423-24795445 GGGCTGCTGTCAGATCCTCCTGG + Intronic
1137768320 16:50994863-50994885 AGGCTGGAGTCAGAGCATGTAGG + Intergenic
1139356661 16:66370981-66371003 AGGCTGTTGGCAGAACCTGCAGG + Intronic
1139556356 16:67713359-67713381 ATTCTGCAGTCAACACCTGCTGG + Intronic
1140702679 16:77596858-77596880 TGGCTGCAGTCTGAATCTTCAGG + Intergenic
1140929133 16:79610827-79610849 GGGCTGCAGTCAAATCTTGCTGG + Intergenic
1141890329 16:86922313-86922335 AGGGTGCCATCATAACCTGCAGG + Intergenic
1141961596 16:87412806-87412828 AGGCTGCGCTCAGCATCTGCGGG + Exonic
1142494012 17:296664-296686 TGGGGGCAGTCAGAACCCGCAGG + Intronic
1143052360 17:4136735-4136757 AGCCTACAGTCTGAACCAGCTGG - Intronic
1143354234 17:6313477-6313499 AGGCTGCATGCAGAACATGGTGG + Intergenic
1144148773 17:12423320-12423342 GGGCTGCAGGCAGAAGCTGAAGG + Intergenic
1147192026 17:38743621-38743643 AGGTAACAGTCAGAACCTGTGGG - Intronic
1147544527 17:41390474-41390496 AGGCTGCTGTCAGCATCTGCAGG - Intronic
1147692515 17:42325264-42325286 AGGCTGCAGTCGGAATATACCGG + Intronic
1147718194 17:42522007-42522029 AGGCTGCAGGCAGAACCAAGAGG - Exonic
1147727082 17:42572523-42572545 CGGCTTCACTCAGGACCTGCTGG - Exonic
1147925467 17:43942900-43942922 AGGCTACAGCCAGAGCCTCCAGG + Intergenic
1150226869 17:63529178-63529200 GGGCTGCAGCCAGACCCTGGAGG + Intronic
1150314665 17:64158426-64158448 GGGCTGCAGGGAGAGCCTGCAGG + Intronic
1151219694 17:72603285-72603307 AGGCTGATTTCAGAACCTCCAGG - Intergenic
1151402381 17:73864298-73864320 AGGCTGGAGGCAGGAGCTGCTGG - Intergenic
1151906866 17:77054497-77054519 ATCCTGGAGTCAGAACCTGCAGG + Intergenic
1152006413 17:77684634-77684656 AGGCACCAGTCAGGACCTGCTGG - Intergenic
1152315001 17:79575076-79575098 AGGCTGCCTTCAGAACCTAGGGG - Intergenic
1152380056 17:79937648-79937670 AGACTTGAGTCAGAACCTTCTGG + Exonic
1155585751 18:27362452-27362474 AGGCTACAGTGAGATCTTGCAGG - Intergenic
1156478289 18:37420238-37420260 ACCCTGCAGCCAGAACCTGGGGG + Intronic
1156789428 18:40953625-40953647 AGGCTGGAGTCAGAGCATCCTGG - Intergenic
1158580326 18:58675220-58675242 AGGCAGCATTTAGAACCTCCTGG - Intronic
1158947991 18:62464340-62464362 AGGCAGGAGCCAGAACATGCAGG + Intergenic
1159966619 18:74601266-74601288 AGGCTGCAGTGAGATGCTGGTGG - Intronic
1160805147 19:989396-989418 CGGCTGCACTCAGGACCTGCAGG - Intronic
1161053444 19:2177675-2177697 AGGGAGCAGGCAGAACTTGCAGG - Intronic
1161995308 19:7707899-7707921 AGGCTGGAGTCCCAACCTCCTGG - Intergenic
1164516850 19:28943936-28943958 AGGTTGGAGGCAGACCCTGCAGG - Intergenic
1165096373 19:33411962-33411984 AGTCTGCAGGCAGAGCCTCCTGG + Intronic
1165122573 19:33570040-33570062 AGAGTGCAGTTAGAAGCTGCAGG + Intergenic
1165350140 19:35270663-35270685 AGGGTGAAGTCAGAACTGGCTGG - Intronic
1166765481 19:45250556-45250578 ATGCTGCAGCCCCAACCTGCGGG + Intronic
1167119907 19:47510680-47510702 AGCCGCCATTCAGAACCTGCAGG + Intronic
1167582066 19:50350884-50350906 TGGCTGCATTTGGAACCTGCTGG - Intronic
1168103639 19:54153893-54153915 AGGCTCCAGGCAGCCCCTGCTGG + Intronic
925020761 2:565835-565857 AGGTTGCATTCAGAATGTGCAGG + Intergenic
925893855 2:8456851-8456873 AGGCTGCAGTCGGGGCCTGACGG - Intergenic
925976724 2:9146868-9146890 AGGCGGGGGTCAGATCCTGCAGG - Intergenic
927647143 2:24885178-24885200 AGGGTGAAGTGAGCACCTGCAGG - Intronic
928667656 2:33566728-33566750 TGGCTGCATCCAAAACCTGCTGG + Intergenic
929557840 2:42936656-42936678 CTGCTGCACTCAGAACCTCCAGG - Intergenic
929594041 2:43164940-43164962 AGGCTGCAGTCTGGAACTCCTGG + Intergenic
930062229 2:47299754-47299776 AGGTTGCAGTCAAGTCCTGCTGG - Intergenic
931127382 2:59293120-59293142 AGGCTTTAATCAGAACCTGCTGG - Intergenic
934614117 2:95760859-95760881 AGTCTGCAGCAAGAAGCTGCTGG + Intergenic
934646802 2:96063684-96063706 AGTCTGCAGCAAGAACCTGCTGG - Intergenic
934840204 2:97619766-97619788 AGTCTGCAGCAAGAACCTGCTGG - Intergenic
937764987 2:125650936-125650958 AGACTGGAGTCAGAGCCTGGAGG - Intergenic
937988759 2:127650709-127650731 TGGCTGGAGTCAGAGCCTGGAGG - Exonic
938087934 2:128413618-128413640 AGTCTGGAGTCAGAAGCTGCAGG - Intergenic
939616275 2:144364966-144364988 AGGCTGCAGGCAGAAACTGATGG + Intergenic
943672117 2:190674208-190674230 AAGCTGCAGTCAGATCATGTGGG - Intronic
944472050 2:200064069-200064091 AGGCTGTAGTTAGAACTTCCAGG + Intergenic
944474958 2:200094068-200094090 GGGCTCCATTCAGAACCTTCAGG + Intergenic
946431656 2:219629689-219629711 AGGCTGCAGCCAGTACCTGCTGG - Exonic
947090703 2:226508186-226508208 AGGTTGCATTTGGAACCTGCTGG - Intergenic
947153736 2:227139435-227139457 GGGCTGCTGTCAGAACATGGGGG + Intronic
947579861 2:231308391-231308413 AGGCTGGCGTGAGAGCCTGCAGG + Intronic
1168757126 20:325610-325632 AGGCTGCAGGAAGAGCCCGCGGG + Exonic
1169193067 20:3669880-3669902 AGGCTGCTGTCAGAGCCTGGAGG - Intronic
1169869990 20:10239872-10239894 AGGCAGCAGCAAGAACCTACAGG + Intronic
1171152628 20:22841216-22841238 GGGCTGCAGTCAGAAGCAGCAGG + Intergenic
1171390326 20:24797544-24797566 AGGATGCAGGAAGAACATGCTGG + Intergenic
1172520509 20:35562663-35562685 GAGCTGCAGTCAGGAGCTGCAGG + Intergenic
1172950209 20:38718589-38718611 AGGCTGCAGGCAGGGCCTGCAGG - Intergenic
1173835691 20:46123758-46123780 AGGATGGAGACAGAACCAGCAGG - Intronic
1177142204 21:17369405-17369427 TCGCTGCAGCCAGAACCTCCAGG - Intergenic
1179722760 21:43324801-43324823 AGGCTGCAGTCAGACCCCGGCGG - Intergenic
1180981820 22:19881924-19881946 AGGCTCCAGGCAGACCCTGCAGG - Intronic
1182188905 22:28438613-28438635 AGACTGCAGTCAAAACCTTCAGG - Intronic
1182311373 22:29410907-29410929 TGGCTGCAGCCACAAACTGCAGG - Intronic
1182689603 22:32149382-32149404 TGGCTGCAGCCACAAACTGCAGG + Exonic
1184268837 22:43365953-43365975 AGGCTGGAGCCAGAATCTGGAGG + Intergenic
1184529891 22:45048729-45048751 AGGCTGCAGTCCGCACCTCGTGG + Intergenic
950162006 3:10767347-10767369 AGGCTGCAGACAGAATGTCCAGG - Intergenic
951897703 3:27626107-27626129 GGGCTGCAGTCAGCTCCTGAAGG - Intergenic
952700027 3:36317894-36317916 AGGCTGAAGCCAGATCCTACAGG - Intergenic
954378898 3:50209233-50209255 AGGTTGCAGTCAGAAGCTCTTGG - Intronic
955158910 3:56445637-56445659 TGGCTGTACTCAGATCCTGCAGG - Intronic
960146038 3:114204112-114204134 AAGCTGCAGTCAGCAACTGAAGG - Intergenic
960439135 3:117665445-117665467 AGGCAGCAGGAAGAACATGCTGG + Intergenic
960479680 3:118172434-118172456 AGGCAGCAGTGGTAACCTGCTGG + Intergenic
961365803 3:126398497-126398519 AAGCAGCAGTGAGAGCCTGCAGG - Intronic
961456651 3:127027898-127027920 AGGCTGCAGCCAGGACCCCCGGG - Intronic
961469418 3:127101837-127101859 ACCCTGCTGTCAGCACCTGCGGG - Intergenic
964204407 3:154156951-154156973 AGGTTGCGGTCAGAACATCCTGG + Intronic
964886723 3:161492031-161492053 AGTCTGCAGTAAGAACCTATTGG - Intergenic
965220082 3:165918034-165918056 AGGCTGCAGTGGCAACCTGCTGG - Intergenic
967131684 3:186476606-186476628 AGGCTGCAAGCAGAAGCTGAAGG + Intergenic
967609335 3:191484497-191484519 AGGCTGGAGTCAGAAGCTCTAGG - Intergenic
967944100 3:194788574-194788596 AGGCTGAACTCAGAATCTTCTGG + Intergenic
968149634 3:196327017-196327039 TAGCTGCAGTGAGTACCTGCAGG + Exonic
968660250 4:1795820-1795842 AGGTTGCAGCCAGCACCTTCGGG - Intronic
968990819 4:3910331-3910353 AGGCAGCAGTCAGGGCCTGATGG + Intergenic
969277782 4:6148642-6148664 AGGATGCAGGCTGAGCCTGCAGG + Intronic
969342858 4:6553235-6553257 AGGCACCAGTCAGAGCTTGCAGG - Intronic
973207731 4:47579099-47579121 AGGCTGCATTCAGATCCAGCAGG - Intronic
975973272 4:80068049-80068071 AGGCTGCACTCAGCATCTGCAGG + Intronic
977362666 4:96026029-96026051 GTGCTGCAGCCAGAAACTGCAGG - Intergenic
978361456 4:107934632-107934654 AGGCAGCAGCCAGATCCTTCAGG - Intronic
979440898 4:120748821-120748843 AGGATGCAGTCAGACCCTGGCGG - Intronic
979565837 4:122152899-122152921 AGGCTGCAGTCCGAGCCTGCGGG - Intronic
982326626 4:154135678-154135700 AGGGTGCCGTCAGACTCTGCTGG - Intergenic
983430930 4:167650054-167650076 AAGCTGGAGGCAGAAACTGCAGG - Intergenic
983511192 4:168611081-168611103 AGGGTCCAGTCAGAGCCTCCTGG - Intronic
984713274 4:182903645-182903667 AGGCTTCCCTCAGAGCCTGCAGG - Intronic
986485338 5:8230181-8230203 GTGCTGCAGTCAGCACCTGATGG + Intergenic
986871104 5:12047926-12047948 AGCCAGCAGTCGCAACCTGCTGG - Intergenic
988490091 5:31698815-31698837 AGGCTGCCGCCCGAATCTGCAGG - Intronic
991460826 5:66856256-66856278 AGGGTGCAGGGAGAACCTGCAGG + Intronic
993421055 5:87701162-87701184 AGGTTGCAGCCAGCAGCTGCAGG - Intergenic
995988333 5:118207681-118207703 AGCCAGCAGTGACAACCTGCAGG - Intergenic
995988469 5:118208285-118208307 AGGCTGCAGGCGGCACTTGCAGG - Intergenic
997199308 5:132000092-132000114 AGGCTGGAGGCAGAATCTCCCGG - Intronic
997445143 5:133935011-133935033 AGGCTGAAGTCAGATCCCCCAGG + Intergenic
997758226 5:136420461-136420483 ATCTTGCAGTCAGAAGCTGCAGG + Intergenic
999065710 5:148683496-148683518 AGGCTGGAGTCAGATCATGCTGG + Intergenic
1000222843 5:159230675-159230697 AAGCTGCAGTCAGATCATGCAGG + Intergenic
1001313264 5:170626047-170626069 AGGCTGGAACCAGACCCTGCAGG + Intronic
1001878136 5:175218541-175218563 AAGCTGCAGTCAGATGGTGCTGG + Intergenic
1002533114 5:179860528-179860550 AGCCTGCGGTCAGAACCACCTGG + Exonic
1003727295 6:8779773-8779795 AGGCTGTAGTCTCAACCTCCTGG + Intergenic
1004244471 6:13959874-13959896 AGGCTGCAGACACAAACTGGGGG + Intronic
1004516232 6:16324659-16324681 CAGCTGCAGGCTGAACCTGCTGG + Intronic
1004966042 6:20852860-20852882 AGGATTCAGCCAGAATCTGCTGG + Intronic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1014240708 6:119015347-119015369 AGGCTGCACGCAGCACTTGCGGG + Intronic
1015116937 6:129660103-129660125 AGGCTGCCGCCAAATCCTGCAGG + Intronic
1015502826 6:133952040-133952062 CGGCTGCAGTCAGAAGCCCCTGG - Intergenic
1017059183 6:150465288-150465310 AGGGTGCAGACAGAAAGTGCTGG + Intergenic
1017146136 6:151237424-151237446 AGGCTGCAGTCTGGAACTCCTGG + Intergenic
1018729429 6:166637526-166637548 AGCCTGCAGTCTGAGCTTGCTGG - Intronic
1019293602 7:262266-262288 TGGCTGAAGTCAGATCCTGGAGG - Intergenic
1019355532 7:576893-576915 AGGCTGGAGTAAGAGCCTGCGGG - Intronic
1019713936 7:2529856-2529878 AGGCTGCGGGCAGAGGCTGCTGG + Intergenic
1021464062 7:20921791-20921813 AGGCTGCAAGCAGCGCCTGCTGG - Intergenic
1024381846 7:48705376-48705398 AGGCTGGAGGCACAACATGCAGG - Intergenic
1024794489 7:53004977-53004999 AGCCAGCAGTGTGAACCTGCTGG + Intergenic
1025913232 7:65844709-65844731 AGGCTGCAGTCTCAAACTCCTGG - Intergenic
1025976393 7:66373750-66373772 AGGCTGCAGTCTCAAACTCCTGG + Intronic
1028610943 7:92710893-92710915 GGGCTGAAGTCAGAACATGCTGG + Intronic
1030285943 7:107826928-107826950 AGGCTGCAGTCAAAACCATAGGG - Intergenic
1030448665 7:109681075-109681097 AGGCTGCTGTCATGACCTACAGG + Intergenic
1031080046 7:117249414-117249436 AGGCTCCACTCACAACCTCCAGG - Intergenic
1031097830 7:117441998-117442020 AGGCTGCAGGCAGAACTTCTAGG - Intergenic
1031506058 7:122585120-122585142 CTGCTGCAGTCAGGATCTGCTGG - Intronic
1034196597 7:149253046-149253068 AGGCGGTAGTCAAAACCTGCTGG + Intronic
1034293462 7:149950296-149950318 AGCCTGCAGGGAGCACCTGCTGG + Intergenic
1034812603 7:154146557-154146579 AGCCTGCAGGGAGCACCTGCTGG - Intronic
1035875460 8:3184080-3184102 AAGCAGCAGTCAGATCATGCAGG - Intronic
1036645755 8:10610878-10610900 AGGCTGCAGGGTGAGCCTGCGGG - Exonic
1037530114 8:19764857-19764879 GGGCTGCAGTCAGGAACAGCAGG - Intergenic
1037664225 8:20954303-20954325 AGGATGGAGACAGAACCTTCTGG + Intergenic
1038328104 8:26587715-26587737 AGACTGCAGACATACCCTGCAGG + Intronic
1043071765 8:75644839-75644861 AGGCTGCAGTCCCAACCTCATGG - Intergenic
1045681906 8:104670026-104670048 GGGCAGCACTCAGAACCAGCAGG + Intronic
1045842615 8:106597347-106597369 AGGCTCCTTCCAGAACCTGCAGG + Intronic
1046595776 8:116259593-116259615 AGGCTTCCTTCAGTACCTGCAGG + Intergenic
1046599489 8:116299636-116299658 AGGCAGCTGTCATATCCTGCAGG + Intergenic
1050195178 9:3075392-3075414 AGGCTGCAGCCAGACCATGGAGG - Intergenic
1052036572 9:23688188-23688210 ACGTTGCAGTCGTAACCTGCTGG + Intergenic
1053218738 9:36294009-36294031 AGGCTGCAGTCAGAACCTGCTGG - Intronic
1053402547 9:37838825-37838847 AGGTTGCAGTGAGCACCTGGGGG + Intronic
1057129373 9:92642332-92642354 AGGCTGCAAGCAGACCTTGCCGG + Intronic
1057297761 9:93859480-93859502 AGGCTGGAGTCTGTACCTGGAGG - Intergenic
1058983576 9:110192059-110192081 TGGCTGCATTCACAACCTGAGGG - Intronic
1059440458 9:114303896-114303918 AGCCTGGAGTCAGAAGCTTCGGG + Intronic
1060266715 9:122115934-122115956 GGGCTGCAGACAGACCCCGCAGG - Intergenic
1061300705 9:129703330-129703352 AGTCTGCAGCCAGGACCTGCAGG - Intronic
1062265615 9:135685369-135685391 AGGCTGGAGTCTGACCCTCCAGG - Intergenic
1062374273 9:136254957-136254979 AGGCTGCTCACAGAGCCTGCTGG + Intergenic
1062572752 9:137193135-137193157 AGGCTCCAGGCAGCTCCTGCTGG + Intronic
1185480231 X:440797-440819 AGGCTGCAGGCCGACCCTGAGGG + Intergenic
1186935851 X:14449673-14449695 AGGCTGCAGGCAAAACATTCAGG - Intergenic
1187072673 X:15903604-15903626 AGGCTACAGGCAACACCTGCTGG - Intergenic
1189497742 X:41524754-41524776 ACGCTGCAGTCAGACGCTGTGGG + Intronic
1190034534 X:47009256-47009278 AGGCTGCAGTGAGCCACTGCAGG + Intronic
1192230629 X:69262450-69262472 AGGCTGGAGACAGCACATGCGGG - Intergenic
1193633285 X:83916686-83916708 GAGCTGCAGTCCTAACCTGCTGG - Intergenic
1196185604 X:112741760-112741782 AGGCTGCAGTTGGAAGCAGCTGG - Intergenic
1197258147 X:124286600-124286622 AGGCTGAAGACAGGACCTGGGGG - Intronic
1198827194 X:140712132-140712154 AGTATGCTGTCAGAAGCTGCAGG - Intergenic
1199534366 X:148885458-148885480 AGGCTGTTGTCAAAGCCTGCTGG - Intronic
1201754361 Y:17470017-17470039 AGACTGGAGTCAGAATCTGCAGG - Intergenic
1201847191 Y:18435968-18435990 AGACTGGAGTCAGAATCTGCAGG + Intergenic