ID: 1053221189

View in Genome Browser
Species Human (GRCh38)
Location 9:36314623-36314645
Sequence TGGCCCCTGGCTACCACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053221185_1053221189 -4 Left 1053221185 9:36314604-36314626 CCAAACTGTGGCTGTCCAGTGGC No data
Right 1053221189 9:36314623-36314645 TGGCCCCTGGCTACCACAGGAGG No data
1053221182_1053221189 19 Left 1053221182 9:36314581-36314603 CCAAGAAAATAGATTGGGAGTTT No data
Right 1053221189 9:36314623-36314645 TGGCCCCTGGCTACCACAGGAGG No data
1053221181_1053221189 20 Left 1053221181 9:36314580-36314602 CCCAAGAAAATAGATTGGGAGTT No data
Right 1053221189 9:36314623-36314645 TGGCCCCTGGCTACCACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053221189 Original CRISPR TGGCCCCTGGCTACCACAGG AGG Intergenic
No off target data available for this crispr