ID: 1053223087

View in Genome Browser
Species Human (GRCh38)
Location 9:36327583-36327605
Sequence AAACTCAACATATCCAAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053223087_1053223092 10 Left 1053223087 9:36327583-36327605 CCATATTTGGATATGTTGAGTTT No data
Right 1053223092 9:36327616-36327638 AGCTGGGGTGTCCAATCTTTTGG No data
1053223087_1053223094 20 Left 1053223087 9:36327583-36327605 CCATATTTGGATATGTTGAGTTT No data
Right 1053223094 9:36327626-36327648 TCCAATCTTTTGGCTTTTCTGGG No data
1053223087_1053223090 -5 Left 1053223087 9:36327583-36327605 CCATATTTGGATATGTTGAGTTT No data
Right 1053223090 9:36327601-36327623 AGTTTGAGTGCCTACAGCTGGGG No data
1053223087_1053223093 19 Left 1053223087 9:36327583-36327605 CCATATTTGGATATGTTGAGTTT No data
Right 1053223093 9:36327625-36327647 GTCCAATCTTTTGGCTTTTCTGG No data
1053223087_1053223088 -7 Left 1053223087 9:36327583-36327605 CCATATTTGGATATGTTGAGTTT No data
Right 1053223088 9:36327599-36327621 TGAGTTTGAGTGCCTACAGCTGG No data
1053223087_1053223089 -6 Left 1053223087 9:36327583-36327605 CCATATTTGGATATGTTGAGTTT No data
Right 1053223089 9:36327600-36327622 GAGTTTGAGTGCCTACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053223087 Original CRISPR AAACTCAACATATCCAAATA TGG (reversed) Intergenic
No off target data available for this crispr