ID: 1053225360

View in Genome Browser
Species Human (GRCh38)
Location 9:36350502-36350524
Sequence GAGAATCAACAGATGGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053225360 Original CRISPR GAGAATCAACAGATGGTCTG TGG (reversed) Intronic
901114984 1:6836292-6836314 GAGAAACCACAGATGGGTTGGGG + Intronic
901522609 1:9796863-9796885 CAGAATGAACAGATGGAATGTGG + Intronic
901912540 1:12472177-12472199 AAGAATCACCAGATTCTCTGGGG - Intronic
908251112 1:62266726-62266748 GAGTACCAAGAGCTGGTCTGTGG + Exonic
908897312 1:68914833-68914855 GAGAATGAACTGTTGGGCTGAGG + Intergenic
909346725 1:74597916-74597938 GAAACTCAACAGATGTTCAGAGG - Intronic
909593895 1:77382687-77382709 AAGAATCCACAGATGGTTGGTGG - Intronic
912570969 1:110620616-110620638 CCTAACCAACAGATGGTCTGAGG + Intronic
913665685 1:121046593-121046615 GAGATTCAACAGATGAACTGAGG + Intergenic
914017082 1:143829868-143829890 GAGATTCAACAGATGAACTGAGG + Intergenic
914160704 1:145131130-145131152 GAGATTCAACAGATGAACTGAGG - Intergenic
914397098 1:147280114-147280136 GAGAAACAAAAGATGGCCAGTGG + Exonic
914655694 1:149738410-149738432 GAGATTCAACAGATGAACTGAGG + Intergenic
915611129 1:156993863-156993885 GAGAATAGACAAATGGTCTCTGG + Intronic
917089621 1:171339793-171339815 GAAAATAAACAGATGGCCTTGGG + Intronic
917546757 1:175977682-175977704 AAGAATATACAGATTGTCTGGGG - Intronic
918269477 1:182883290-182883312 GACAATTAACAGATGATTTGTGG - Exonic
920833549 1:209487017-209487039 GGGAATCTACAGAAGGGCTGGGG - Intergenic
922759730 1:228120134-228120156 GAGTTTCAACATATGGTCTCTGG + Intergenic
923302517 1:232655093-232655115 CAGAATCAGCAGATGGGCTGGGG - Intergenic
923977885 1:239285288-239285310 CAGAATCACAAGATGGGCTGAGG + Intergenic
924067967 1:240245790-240245812 GTGAAGCAACAGAAGGCCTGGGG - Intronic
1064525791 10:16255244-16255266 GAGAATCAAAATATGATTTGAGG - Intergenic
1065504928 10:26420523-26420545 GAGTTTCACCAGATAGTCTGAGG + Intergenic
1067137121 10:43619927-43619949 TGGAATCAACAGTTGGTCAGTGG + Intergenic
1067272246 10:44802527-44802549 TAGAATCTATAGATTGTCTGTGG - Intergenic
1067732923 10:48825604-48825626 AAGAAACAACAGATGGGGTGAGG - Intronic
1067843229 10:49698554-49698576 GACAATCAACAAATGCCCTGGGG + Intronic
1072027438 10:91475812-91475834 GAGAATCTAGAGATGAACTGTGG + Intronic
1072430316 10:95365435-95365457 GAGAATAAAGAGGTGGCCTGGGG + Intronic
1075247075 10:120832239-120832261 GAGAATCCACAAATGCTTTGAGG + Intergenic
1075819310 10:125292068-125292090 AAGAGTAAACAGATGGTCTTTGG - Intergenic
1078395698 11:10980136-10980158 GAAACTCAACAGAAGGACTGAGG - Intergenic
1079452420 11:20608663-20608685 GAGAATTAACAGATCTACTGGGG - Intronic
1080421607 11:32116051-32116073 GAGATTTTACAGAAGGTCTGGGG + Intergenic
1081960276 11:47130899-47130921 GAGAGTCCACACATGGGCTGTGG + Intronic
1082193405 11:49273772-49273794 GAGAATGAACAAATAGACTGGGG + Intergenic
1082866826 11:57907799-57907821 GAGTTTCAACATATGGTCTCTGG + Intergenic
1083243496 11:61407586-61407608 TAGAATCAACAGTTAGGCTGTGG - Intronic
1088790364 11:113220311-113220333 GAGAATGCACAGATGGTATGTGG - Intronic
1088887809 11:114021309-114021331 GAGGTCCTACAGATGGTCTGGGG - Intergenic
1092244108 12:6853394-6853416 GAGAAGCAGCACATTGTCTGAGG - Intronic
1096554368 12:52394392-52394414 GAGAATCAAGAGGTGGCCTTTGG - Exonic
1096876649 12:54634870-54634892 CAGAATCTGCAGAAGGTCTGGGG + Exonic
1097914086 12:65001919-65001941 GAGAATCATCAGAAGGTAAGAGG - Intergenic
1099281891 12:80660272-80660294 GAGGACCAGCATATGGTCTGAGG + Intronic
1100080685 12:90846442-90846464 GAGAAACAACAGAAGTTGTGGGG - Intergenic
1101188369 12:102305657-102305679 GAGTTTCAACACATGGTCTCTGG - Intergenic
1101232082 12:102751885-102751907 GAGAACTACTAGATGGTCTGGGG - Intergenic
1107950551 13:45457545-45457567 GAGAATTAACAGATTGTATTTGG - Intergenic
1108895458 13:55321417-55321439 GAGAATAAATAGATAGTATGAGG + Intergenic
1110268289 13:73564691-73564713 GAGTATGAACAAATGGTATGAGG + Intergenic
1110569323 13:76987910-76987932 GACAATTAACAGATGATTTGTGG - Intergenic
1112302532 13:98242993-98243015 GAGAATGAACAGTAGGTCTTGGG - Intronic
1118186436 14:63542795-63542817 AAGAATCCAAAGATGATCTGTGG + Exonic
1118282856 14:64444957-64444979 GAGAATCAACCACTGGTCTAGGG - Intronic
1118711785 14:68525517-68525539 GAGAATTCCCAGATGGTCAGTGG - Intronic
1120969448 14:90195188-90195210 GAGAATGAACAGATCGTATCTGG + Intergenic
1121497057 14:94400047-94400069 GAGAATCTAAGGATGATCTGAGG - Intergenic
1121637708 14:95465100-95465122 GAGAATGGACAGAGGGACTGGGG + Intronic
1122161091 14:99784560-99784582 GACTATCAACAGATTATCTGTGG + Intronic
1122691836 14:103535249-103535271 GAGAAGCACGAGATGGTCTCAGG - Exonic
1122970473 14:105150149-105150171 CAGTACCAACAGATGGTCAGAGG + Intronic
1126663672 15:51056145-51056167 GAGCATCAAGAGATGGTTTGTGG - Intergenic
1127025237 15:54797701-54797723 GAGTATCTACAAATGGCCTGTGG - Intergenic
1128605246 15:69032003-69032025 CAGAATCAACTCAAGGTCTGAGG + Intronic
1128796407 15:70469806-70469828 GAGAGGGAACAGGTGGTCTGGGG + Intergenic
1129976585 15:79827455-79827477 AAGAATCAACAAATGCTTTGAGG - Intergenic
1130229656 15:82086971-82086993 GAGAATCAACAGTGGTTCAGAGG + Intergenic
1133955807 16:10442988-10443010 GAGAATCAAAAGATCGTGAGGGG + Intronic
1140567846 16:76065022-76065044 GAGATTCAACAGACACTCTGGGG - Intergenic
1144966273 17:19078640-19078662 GAGTTTCCAGAGATGGTCTGAGG + Intergenic
1144981645 17:19173417-19173439 GAGTTTCCAGAGATGGTCTGAGG - Intergenic
1144986579 17:19204822-19204844 GAGTTTCCAGAGATGGTCTGAGG + Intergenic
1148955838 17:51353019-51353041 GAGAATGAATAGAAGGGCTGTGG - Intergenic
1151330247 17:73402217-73402239 GCCAATCAACAGATGGTGTCCGG + Intronic
1155828558 18:30481563-30481585 GGAAATCAATAGATGGACTGTGG + Intergenic
1157010374 18:43641129-43641151 GAGAAAAATCAGATGGGCTGTGG + Intergenic
1158821778 18:61168175-61168197 GAGAATCAAAAAATGTTGTGTGG + Intergenic
1159823731 18:73178732-73178754 GAGAATCAAGAGATGGAGAGGGG + Intronic
1160321267 18:77897883-77897905 CAGAATCAACATATAGCCTGTGG + Intergenic
1162548743 19:11346613-11346635 GAGCATGAACAGGTGGTATGTGG + Exonic
1165995998 19:39844610-39844632 CAGAACCAACAGATTGTATGTGG - Intronic
1168259607 19:55186059-55186081 GTGAACCAGCAGATGGGCTGGGG + Intronic
927917295 2:26945424-26945446 GAGATTCCACAGAAGGACTGGGG - Intronic
928121863 2:28589582-28589604 TAGAATCCACAGATAGTGTGTGG + Intronic
928886212 2:36151538-36151560 GAGGAACAGCAGATGGGCTGAGG + Intergenic
931219098 2:60273208-60273230 AAGATTCAACAGCTGGCCTGTGG - Intergenic
931611491 2:64106137-64106159 AGGAATCGACAGAGGGTCTGGGG - Intronic
931811044 2:65855410-65855432 GCGAACCAACAGAGAGTCTGTGG - Intergenic
933477842 2:82815665-82815687 GAGAGTCATCAGTTGGTCTTAGG + Intergenic
933689757 2:85170837-85170859 GAAAGACAACAGATGGGCTGTGG + Intronic
934888909 2:98048464-98048486 GAGTATCAACATATGGTCTCTGG - Intergenic
935404281 2:102691832-102691854 AGGAATCAACATATGGACTGGGG + Intronic
935761117 2:106321626-106321648 GAGCATCAACTGATGGTAAGGGG + Intergenic
938617002 2:133009766-133009788 GAGCATCAACAGAGGCTCTCTGG + Intronic
940081519 2:149808422-149808444 GAGAATCAAGAGGTGGTGTCTGG - Intergenic
940661621 2:156552643-156552665 CAGAATTAACATAAGGTCTGTGG - Intronic
941616593 2:167727469-167727491 GGGAATCAGAAGATGGACTGTGG - Intergenic
941708708 2:168688499-168688521 GAGAATCAACTCATGGACTTCGG + Intronic
941830738 2:169955897-169955919 TAGAATAAACACATGGACTGGGG - Intronic
942200635 2:173567572-173567594 GAGCAGCATCAGATGGTCTGAGG - Intergenic
942436219 2:175980067-175980089 GGGGATCATCAGAAGGTCTGTGG - Intronic
942491011 2:176490003-176490025 CAGAATCACCAGCTTGTCTGTGG - Intergenic
944172274 2:196793130-196793152 GAGAAACATCAGATGGAGTGAGG - Exonic
947720331 2:232366112-232366134 GAGAGTTACCAGAAGGTCTGCGG + Intergenic
948677527 2:239607567-239607589 AAGAAGCAAAAGATGGACTGAGG + Intergenic
1170330486 20:15205170-15205192 GAAGATCACCAGATGGTATGTGG + Intronic
1170642377 20:18165880-18165902 GAGCATCATCAGCTGGTCTTTGG + Intronic
1177703721 21:24673633-24673655 GAGAATCAAGATCTGGTCTCTGG + Intergenic
1178315924 21:31566793-31566815 GAGAGTAAACACATGGTTTGAGG - Intergenic
1179125273 21:38584706-38584728 AAGAATCCAGAAATGGTCTGTGG + Intronic
1181113444 22:20615904-20615926 CTGAATCAACAGAAGGCCTGTGG + Intergenic
1183165505 22:36144383-36144405 GAGAATGAACAGCAGGTCAGAGG - Intronic
1184460490 22:44635081-44635103 GAGAAACAAAATCTGGTCTGTGG + Intergenic
1185011122 22:48315298-48315320 GAGAAACCCCAGATGATCTGTGG - Intergenic
949954816 3:9259017-9259039 GAGAAGCAAGAGATGGGCTTAGG - Intronic
949960020 3:9304312-9304334 GAGAATAAAAGGAAGGTCTGGGG - Intronic
953571559 3:44075804-44075826 GAGAATCAAGAGATGGGGTGTGG + Intergenic
954388924 3:50258847-50258869 GAGAATGAGCAGGTGGACTGTGG - Exonic
955070736 3:55570619-55570641 GGGGAAGAACAGATGGTCTGTGG + Intronic
955454152 3:59101451-59101473 GAGTTTCAACACATGGTCTCTGG - Intergenic
960882146 3:122355947-122355969 GAGAATGCACAGATGTTCAGAGG + Intergenic
964736932 3:159927298-159927320 GAGAACTACCAGCTGGTCTGTGG + Intergenic
967919183 3:194601933-194601955 GAGAAGCAACATTTGTTCTGTGG - Intronic
969154677 4:5200080-5200102 GAGACTTAACAGATTGTCTGAGG - Intronic
969735664 4:8988310-8988332 GAGAAACAACAGTTGGCCTAGGG - Intergenic
972762578 4:42121652-42121674 GACAATCAAAAGATGGGCAGGGG + Intronic
973209980 4:47604952-47604974 GAGAATGAACATATGGTGTAGGG - Intronic
976516414 4:85972723-85972745 GAGAATTAAGAGAGGGTATGGGG - Intronic
978777714 4:112519751-112519773 GAGTATGAACAGTTGGTCTTTGG - Intergenic
979223292 4:118254735-118254757 GAGAACCCTAAGATGGTCTGAGG + Intronic
981230582 4:142349931-142349953 GAGAATAAACAGATATTCAGTGG - Intronic
981783567 4:148452823-148452845 AAAAATCAACATATAGTCTGAGG - Intergenic
983039142 4:162903500-162903522 AAGAATCAGCAGATTGTGTGTGG - Intergenic
984164500 4:176290721-176290743 GAGAATGACCCTATGGTCTGAGG + Intergenic
987325726 5:16810410-16810432 GAGAAAGGACAGATGGGCTGAGG - Intronic
990330621 5:54721932-54721954 GAGAATAAAAAAATGGTCTTTGG - Intergenic
992123251 5:73615688-73615710 GAAAAGCAAGAGATGGTCTGAGG + Intergenic
994709310 5:103247278-103247300 GAGAAACAGCTGATGGCCTGGGG - Intergenic
995033196 5:107502921-107502943 GCCAGTCAACAGATGGTCTCTGG + Intronic
995145565 5:108784439-108784461 GACAACCAGCAGATTGTCTGTGG + Intronic
999381076 5:151121935-151121957 GAGACTCAAATGATGTTCTGTGG - Intronic
1002932301 6:1643094-1643116 GAGAATCACCAGTTTCTCTGGGG - Intronic
1005448840 6:25953697-25953719 GAGTTTCAACATATGGTCTCTGG + Intergenic
1008853113 6:56048724-56048746 GAGAATCATGGGATGGTGTGGGG + Intergenic
1010394864 6:75379512-75379534 GAGAAACAACAGAGACTCTGAGG + Intronic
1012616707 6:101286225-101286247 GAAAATCAACAGATCCTCAGAGG - Intergenic
1012853755 6:104476753-104476775 GGAAATAAACTGATGGTCTGTGG - Intergenic
1015895297 6:138011122-138011144 GAGAATCAACACATGCTTTATGG - Intergenic
1021990342 7:26135207-26135229 CAGACTCTACAGATGGTTTGAGG + Intergenic
1022071479 7:26919815-26919837 GAGAATCTTCAGATTGTCTCTGG - Intronic
1022557417 7:31312580-31312602 GAGATTCAACAGTTAGTATGGGG - Intergenic
1022566155 7:31404547-31404569 GAGCTTCAACAGATGATTTGGGG - Intergenic
1027339375 7:77189685-77189707 GTGAAACAGCAGAGGGTCTGGGG - Intronic
1028069985 7:86440088-86440110 GAAAATCAACAGATGACATGAGG + Intergenic
1028328228 7:89554163-89554185 GAGAATCAATATATAGCCTGTGG + Intergenic
1029811164 7:103050551-103050573 GAGTTTCAACACATGGTCTCTGG + Intronic
1030582898 7:111382549-111382571 CAGAATCAAGGGATGGTTTGGGG + Intronic
1030852929 7:114513266-114513288 CAGAACCAACAAATGGTCAGGGG + Intronic
1031497594 7:122469995-122470017 GAGAATAAACAGATTTTTTGCGG + Intronic
1032521341 7:132547747-132547769 GAGAATCAAATCAGGGTCTGCGG + Intronic
1033599602 7:142879327-142879349 AAGAATAAAGAGATGATCTGGGG - Intronic
1035698249 8:1617375-1617397 GACAAACAACAGATGCTGTGAGG - Intronic
1038782338 8:30579061-30579083 TAGAAACAACAGCTGCTCTGAGG + Intronic
1046813686 8:118560246-118560268 GAGAATCCACAGACATTCTGGGG + Intronic
1048232677 8:132659200-132659222 GGGAAGACACAGATGGTCTGCGG - Intronic
1049672152 8:143874745-143874767 GAGAATCAAGAGAGGGACTGGGG - Intronic
1053225360 9:36350502-36350524 GAGAATCAACAGATGGTCTGTGG - Intronic
1054735175 9:68743816-68743838 GAGAATCAATAGAAGGACAGGGG - Intronic
1054880048 9:70135215-70135237 GATCATCAACAGATGCTCAGAGG + Intronic
1055066867 9:72127680-72127702 GAGAATCAACAGTATGTCTGTGG + Intronic
1055620886 9:78123900-78123922 AAGAAGCAATACATGGTCTGTGG + Intergenic
1056037128 9:82618471-82618493 GAAAATGAACAGAGGGTCTTTGG + Intergenic
1056709248 9:88977373-88977395 GAGAATCAACAGATGATCTAGGG + Intergenic
1058132399 9:101267609-101267631 GTGAATGAAGAGATGGTTTGTGG + Intronic
1058934199 9:109752779-109752801 GCGATGCAACAGATGGACTGGGG + Intronic
1059869344 9:118554273-118554295 GAGAATAAATAACTGGTCTGGGG - Intergenic
1059935802 9:119309370-119309392 GGGATTCAAAAGCTGGTCTGTGG - Intronic
1060498186 9:124133240-124133262 GAGACTCAAGAGATGGAGTGAGG + Intergenic
1060902426 9:127271752-127271774 GAGAGTCAGCAGCTGGGCTGGGG - Intronic
1062328809 9:136026822-136026844 GAGAAGCAACAGGAGGTCAGAGG + Intronic
1187962943 X:24583918-24583940 AAGATTCCACAGATGATCTGAGG + Intronic
1188092763 X:25983309-25983331 TAGAATAAACAAATTGTCTGAGG + Intergenic
1188126413 X:26374352-26374374 GAGATTCAACATGTTGTCTGTGG + Intergenic
1190815403 X:53924794-53924816 GAGTTTCAACACATGGTCTCTGG - Intergenic
1192124327 X:68487788-68487810 GAGAATCCACACATGGACAGAGG + Intergenic
1192433367 X:71127291-71127313 GAGGGTCAGCAGATGGTATGCGG - Intronic
1193937058 X:87636471-87636493 GAGAATCCACAGACCCTCTGAGG + Intronic
1195687093 X:107597285-107597307 GAGAATCAACAGATGAGCCCTGG - Intronic
1198314597 X:135452992-135453014 GAAACACAACAGAGGGTCTGGGG - Intergenic
1198333466 X:135643747-135643769 GAGAATCATCAGATTGTGTTTGG - Intergenic
1198720673 X:139615892-139615914 GACCATCAGCAGATGCTCTGTGG - Intronic
1200112822 X:153751058-153751080 GAGATAGAACAGAAGGTCTGTGG + Intergenic
1202069651 Y:20977516-20977538 GTGGATCAACAGATGATGTGTGG - Intergenic