ID: 1053227744

View in Genome Browser
Species Human (GRCh38)
Location 9:36375526-36375548
Sequence CTGTATCCTCAAAGGCAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053227744_1053227748 -8 Left 1053227744 9:36375526-36375548 CCTAATTGCCTTTGAGGATACAG 0: 1
1: 0
2: 1
3: 10
4: 193
Right 1053227748 9:36375541-36375563 GGATACAGAAGGAAAAGGAATGG No data
1053227744_1053227749 3 Left 1053227744 9:36375526-36375548 CCTAATTGCCTTTGAGGATACAG 0: 1
1: 0
2: 1
3: 10
4: 193
Right 1053227749 9:36375552-36375574 GAAAAGGAATGGAGTAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053227744 Original CRISPR CTGTATCCTCAAAGGCAATT AGG (reversed) Intronic
901112872 1:6812947-6812969 CAGTAACCTCTAAGGTAATTGGG - Intronic
902169790 1:14600119-14600141 CTGTTTCTTAAAGGGCAATTAGG - Intronic
902584224 1:17428129-17428151 CTGTATCTTCAATGTCAACTGGG + Intronic
904960555 1:34329442-34329464 CTTTATGCTCAAACGCCATTTGG - Intergenic
906643916 1:47459233-47459255 CTGTGTCCTCAATAGCAAATTGG + Intergenic
908684222 1:66696951-66696973 CTGCATACTTAAAGGCACTTTGG + Intronic
909748460 1:79128630-79128652 CAATATCCTCAAAGACAACTTGG - Intergenic
910551789 1:88483277-88483299 CTCTTTCCTCAAAGGGAAATGGG - Intergenic
911539969 1:99146468-99146490 CTGGATCCACAACTGCAATTTGG - Intergenic
914958374 1:152184815-152184837 CTGTCTCCTCAGTGGCAATACGG - Intergenic
918352779 1:183674912-183674934 CAGTATCTTCAAAAGTAATTAGG + Intronic
922384177 1:225065001-225065023 CAGTTTCCTCAAAGGTAAATTGG + Intronic
922955995 1:229600883-229600905 CTGTATCATCAAAGCTAATAAGG + Intronic
924140769 1:241020889-241020911 TTTTATCCACAAAAGCAATTTGG + Intronic
1068037658 10:51781379-51781401 CTGTTTCCCCAAAGGCAAGAGGG + Intronic
1070360229 10:75681304-75681326 CTTCCTCCTCAAAAGCAATTTGG - Intronic
1071639129 10:87288266-87288288 CTGTTTCCTCAGCTGCAATTGGG - Intergenic
1071656108 10:87449683-87449705 CTGTTTCCTCAGCTGCAATTGGG + Intergenic
1072458699 10:95600172-95600194 CTTTTTCCTCATAGGCAACTTGG + Intergenic
1074003972 10:109400313-109400335 CTATATCATCAAAGTCAATTTGG - Intergenic
1074327976 10:112471427-112471449 GTGTAGCCTCAAAGGAAGTTAGG + Intronic
1075340730 10:121645182-121645204 CTTCATCCTCAAAGCCACTTGGG + Intergenic
1075915430 10:126162338-126162360 CTGCATCCTCAAAGGCATGGGGG + Intronic
1077503026 11:2917739-2917761 CTGAATCCCCAGAGGCACTTAGG - Intronic
1077622726 11:3741760-3741782 CTCTATCCTCAAAAGCATTTAGG - Intronic
1078351449 11:10598082-10598104 CTATATCCTCAGATGGAATTTGG - Intronic
1080410058 11:32014781-32014803 ATGTACCCTCAAAGGAAATTTGG + Intronic
1083949083 11:65944083-65944105 CTGTTTTCTCATAGGCAATGGGG - Intergenic
1088501696 11:110489903-110489925 ATGTTTCCTCTAAGGCAATCAGG + Intergenic
1089120888 11:116134166-116134188 CTGTCTCCGGAAAGGAAATTTGG - Intergenic
1091171624 11:133524869-133524891 CTGAGTCCTCAAAGGCATTGAGG - Intronic
1093157853 12:15709615-15709637 CTGGATTCTAAAAGCCAATTGGG - Intronic
1094145660 12:27226010-27226032 TTGTAACCTGAAAGGCATTTGGG - Intergenic
1096079294 12:48823164-48823186 CTGTAGCCTCAGAGGCACTGGGG + Intronic
1099407501 12:82281998-82282020 CTGTATCCTGAAAAGCAATAGGG + Intronic
1100092878 12:90992969-90992991 CTGTGTACTCAAACACAATTTGG - Intronic
1101021269 12:100556643-100556665 ATGTTTCACCAAAGGCAATTTGG + Intronic
1101371475 12:104135234-104135256 CTGTAGCCTCAACAGCACTTAGG + Intronic
1102426402 12:112847680-112847702 CTGGAGCCTGAAAGGAAATTTGG - Exonic
1103133232 12:118486488-118486510 CCGTGTCCCCAAAGGCAAGTTGG + Intergenic
1104421527 12:128639813-128639835 TTGTAACCCCAAAGTCAATTTGG - Intronic
1104425944 12:128678205-128678227 CTTTATCCTCAAGAGCCATTTGG + Intronic
1104550052 12:129748393-129748415 GTGTGTCCTCAAAGCCCATTTGG - Intronic
1105267291 13:18832531-18832553 CTTTATCCTCAGAGTTAATTGGG - Intergenic
1107706016 13:43105987-43106009 TTGTATCCTCAAGGGCAAAGAGG + Intronic
1108727418 13:53198421-53198443 CAGTATCCTCAATGGCATGTTGG - Intergenic
1110297569 13:73886191-73886213 ATGTATCCTCAATGGGAAATGGG + Intronic
1113607295 13:111618773-111618795 CTGTTTCCTCAAAGGCCAAGGGG + Intronic
1114187817 14:20416345-20416367 CTAGATCCTCAAAGCCAATCAGG - Intergenic
1120544824 14:85798319-85798341 CTGTATAGTCAAATTCAATTTGG + Intergenic
1123185742 14:106515343-106515365 CTTCTTCCTCAAAGACAATTAGG + Intergenic
1202831478 14_GL000009v2_random:38954-38976 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1125404762 15:39340764-39340786 CTTAATCCTCAAAGCGAATTAGG + Intergenic
1126397718 15:48236586-48236608 CTGTATCCTCAAAGCTAGTAAGG + Intronic
1126504263 15:49385358-49385380 CTGTTTCCTCAAACATAATTTGG + Intronic
1127041149 15:54978257-54978279 CTGTTTCCTAAAATCCAATTTGG - Intergenic
1128200286 15:65799458-65799480 CTGTATGCTAAAAGGGAATGGGG + Intronic
1129538398 15:76332606-76332628 CTGTTTGCTCAAAGGGAATCTGG + Intergenic
1130966590 15:88701743-88701765 CTGTACCATCAAAGGCAAGGGGG - Intergenic
1132349386 15:101129522-101129544 CTGTAGCCTCAAAGGCAGAGAGG - Intergenic
1134503483 16:14787293-14787315 CCATTTCCTCAAAGGCAAATTGG - Intronic
1134577085 16:15341605-15341627 CCATTTCCTCAAAGGCAAATTGG + Intergenic
1134725355 16:16414888-16414910 CCATTTCCTCAAAGGCAAATTGG - Intergenic
1134942077 16:18296970-18296992 CCATTTCCTCAAAGGCAAATTGG + Intergenic
1135435894 16:22426373-22426395 CTGTGTGCTCAAATGTAATTTGG - Intronic
1135555152 16:23430059-23430081 CTGGATCCTGAAAGGGGATTAGG + Intronic
1139014817 16:62677381-62677403 TTCTATCCTCAAAAGTAATTGGG - Intergenic
1146218775 17:31000321-31000343 TTGTTTCCTCAAAGACAATAAGG + Intergenic
1146764709 17:35508835-35508857 CTGTATCATCAAAGCTAATAAGG - Intronic
1147559384 17:41499644-41499666 CTGCTTCCTCAAGGGCAGTTTGG + Intergenic
1149623901 17:58066133-58066155 CTGTTTCCTGAGAGGCAATATGG - Intergenic
1150863080 17:68821388-68821410 TTGTCTCTTCAAAGGCAAGTAGG + Intergenic
1154421119 18:14228899-14228921 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1157231085 18:45916641-45916663 CTGTTTCCTCATAAGTAATTAGG - Intronic
1157663842 18:49468970-49468992 CTGTACCCTCCAAGGCACTGTGG + Intergenic
1157728655 18:49984969-49984991 CTTTATCCACAACGGCAAATGGG + Intronic
1158033321 18:52993556-52993578 CTGTATTGTCAAAGGAAATTTGG + Intronic
1159872363 18:73772824-73772846 CTGGACCCCCAAAGGCAACTGGG + Intergenic
1160069419 18:75612325-75612347 CTGAATTTTGAAAGGCAATTGGG - Intergenic
1163661624 19:18581411-18581433 AGGGATCCTCAAAGGCAAATAGG - Intronic
1164716303 19:30392935-30392957 CTGAATACTCAATGGCATTTTGG + Intronic
1166008342 19:39923110-39923132 CTGTATCTTAATGGGCAATTTGG + Intronic
1167805232 19:51778448-51778470 CTGTTTCATCAGAGTCAATTGGG + Intronic
1168058739 19:53878871-53878893 CTACATCCGCAAAAGCAATTGGG + Intergenic
1202641218 1_KI270706v1_random:88786-88808 CTTTATCCTCAGAGTTAATTGGG - Intergenic
925323014 2:2991458-2991480 CTATTTCCTCAAAGGCAAATTGG + Intergenic
926761675 2:16283883-16283905 CTCCATCTTCAAAAGCAATTTGG + Intergenic
926874834 2:17464257-17464279 TTGAATCCTCAAAGACAGTTTGG + Intergenic
927384114 2:22513352-22513374 CTGCTCCCTCAAAGGCAAATGGG - Intergenic
927990465 2:27443382-27443404 CTGTATCCTGAAAAGCAAGAAGG - Exonic
928246122 2:29629098-29629120 CTGCATACACAAAGGCAATGGGG + Intronic
928817240 2:35312805-35312827 CAGTATCCTCAAAAGCAAAATGG + Intergenic
928884848 2:36136395-36136417 CTTCATCTTCAAAGGCATTTAGG - Intergenic
930038767 2:47104559-47104581 CGGGATCCTCAAAGGCAAAGAGG - Intronic
930554704 2:52880877-52880899 CTGGATCCTAAAATGAAATTTGG - Intergenic
931533096 2:63239374-63239396 CTATATTCTCAAGGGGAATTTGG - Intronic
935065934 2:99647796-99647818 CTTTATCCTCAAATGTAATAGGG - Intronic
935315293 2:101827493-101827515 CTGTGTTCTCAAAGACAGTTGGG + Intronic
937496565 2:122426410-122426432 CTGTGTCCTCACAGGCAAGAAGG - Intergenic
939402597 2:141713439-141713461 CCGTTTCCTCAAATGCACTTTGG - Intronic
944125374 2:196287010-196287032 CTGTAGCCACACAGGCTATTAGG + Intronic
947279688 2:228436747-228436769 CTCTATCCTCAATGCCACTTTGG + Intergenic
1169933551 20:10858788-10858810 CTGTGTCCTCTAAGGTACTTAGG + Intergenic
1171138224 20:22717536-22717558 CCTTGTCCTCAAATGCAATTTGG + Intergenic
1171344556 20:24456077-24456099 ATGTAGCCCTAAAGGCAATTGGG - Intergenic
1171888320 20:30679003-30679025 CTTTATCCTCAGAGTTAATTGGG - Intergenic
1173208118 20:41010740-41010762 CTGTAGCCTCAAAAGGGATTTGG - Intergenic
1176610665 21:8883785-8883807 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1176852355 21:13931062-13931084 CTTTATCCTCAGAGTTAATTGGG - Intergenic
1180360742 22:11893089-11893111 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1181360505 22:22330634-22330656 CTGTGTCCTCACAGGAAACTGGG + Intergenic
1181966864 22:26662679-26662701 CTGGCTCATCCAAGGCAATTTGG + Intergenic
1182439716 22:30356126-30356148 CTGTATCATCGATGGCCATTGGG + Intronic
950505099 3:13389600-13389622 CTGTCTCCACAAGGGCAACTCGG + Intronic
950979977 3:17292152-17292174 GTGTTCCTTCAAAGGCAATTTGG - Intronic
951419507 3:22467632-22467654 CAGTTTCCTCAATGGCAAATGGG - Intergenic
951707829 3:25561313-25561335 CTGTAGCATAAAAGGCATTTGGG + Intronic
957404076 3:79754603-79754625 CTTTCTCCTCATAGGCAGTTTGG + Intronic
958089653 3:88860187-88860209 TAGTACCCTCAAAGGTAATTTGG + Intergenic
959732823 3:109623314-109623336 CTGTCTCCTCCAAGTGAATTTGG - Intergenic
959802674 3:110513464-110513486 CTGAAACCTCAAAGGACATTTGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960564314 3:119117756-119117778 CTGTAAAATCAAAGGCAAGTTGG + Intronic
964117773 3:153154756-153154778 CTTTTCCCTCAAAGGAAATTGGG + Intergenic
964743872 3:159993623-159993645 CTCTTTCCTCAAATGCAATGGGG + Intronic
966471030 3:180289065-180289087 CTGTAATCTCAAAGGAAATTGGG + Intergenic
1202737348 3_GL000221v1_random:18571-18593 CTTTATCCTCAGAGTTAATTGGG + Intergenic
969016921 4:4109299-4109321 CTCAATCCCCAAAGGCAATGTGG + Intergenic
970008465 4:11432359-11432381 CTTTATCCACAAAGGAAATTGGG + Intergenic
970881277 4:20935060-20935082 CTGTGTCCTCAAGGGACATTTGG - Intronic
971137754 4:23888493-23888515 CCGGCTACTCAAAGGCAATTAGG + Intronic
972139616 4:35941518-35941540 CTGTTTTCCCAAAGGCAACTTGG - Intergenic
972386242 4:38569121-38569143 CTGTATCCTCAAAGGACTTATGG - Intergenic
973384731 4:49499313-49499335 CTTTATCCTCAGAGTTAATTGGG - Intergenic
973934781 4:55832872-55832894 CTGTATCCTCAGAGCCTAGTGGG - Intergenic
974606132 4:64153696-64153718 CAGAAGCCTCAAATGCAATTTGG + Intergenic
976239591 4:82940839-82940861 CTGTATCCTCATCTGCAATATGG + Intronic
976919460 4:90420817-90420839 CTGTATCCTCTAATGAACTTGGG - Intronic
979617600 4:122761656-122761678 CTGTATTCTCCAATGCAATGAGG + Intergenic
980637983 4:135534962-135534984 CTGGAAACTGAAAGGCAATTAGG + Intergenic
982432466 4:155338409-155338431 CTGTATCCTCAAAAGCCACAAGG + Intergenic
983062558 4:163175535-163175557 AGGGATCCTCAAAGGCAAATAGG - Intergenic
984464594 4:180082022-180082044 CTGTTACTTCAAAGGCTATTTGG - Intergenic
987161023 5:15142834-15142856 CTGTATCCTCAGATTCAATCAGG + Intergenic
987624715 5:20383672-20383694 ATGTATCCAAAAAGGCATTTTGG - Intronic
989488928 5:42027317-42027339 CTGTATGCTCATAGTTAATTGGG - Intergenic
989566408 5:42905587-42905609 GTGTGTCCTCAAAGACAACTTGG - Intergenic
991257742 5:64633844-64633866 CTTTATCCTGAAAGGCAAGCTGG + Intergenic
991503900 5:67304491-67304513 TTCTATGCTCAAAGGCAACTAGG - Intergenic
998402546 5:141855541-141855563 CTCTATCCTCAGATGAAATTGGG + Intronic
999019547 5:148148638-148148660 CTGTTTCCTTAAATGCAATGTGG - Intergenic
999588010 5:153112248-153112270 CTCTTTCCTGAATGGCAATTGGG - Intergenic
999614500 5:153407626-153407648 ATGTTTCCTCAAAGGGCATTTGG + Intergenic
1000646404 5:163765390-163765412 CTTGTTCCTCAAAGGAAATTAGG + Intergenic
1001104157 5:168839049-168839071 CTGTAACATCAAAGGCAATTTGG + Intronic
1001173403 5:169443014-169443036 TGATATCCACAAAGGCAATTTGG + Intergenic
1003706712 6:8539822-8539844 CTGTATCCCCAAATGCTTTTTGG - Intergenic
1003787707 6:9505631-9505653 GTGTTTCCTCAAAGACAATGTGG + Intergenic
1007442671 6:41876731-41876753 TTGTATCTTCCAAGGCATTTGGG - Intronic
1008513425 6:52298084-52298106 CTGTGTGAGCAAAGGCAATTGGG - Intergenic
1013158138 6:107513576-107513598 CTGTTTTCTCAATGGCTATTTGG - Intronic
1015748609 6:136537691-136537713 CTGTATACAAAAAGACAATTTGG + Intronic
1020638639 7:10727925-10727947 CTGTATCTTAAAAGACACTTGGG - Intergenic
1021310658 7:19091914-19091936 CTTTATCCCCAAAGGCAACTTGG - Intronic
1022291412 7:29007678-29007700 CTGTTTCCTCCAAGACACTTTGG + Intronic
1023526485 7:41108788-41108810 ATGTATGCACAAAGGCCATTGGG + Intergenic
1023750055 7:43363676-43363698 CTGTATTTTCACGGGCAATTAGG + Intronic
1025854384 7:65264967-65264989 CTGTATCAGCAAAGGCCTTTGGG + Intergenic
1026219263 7:68378320-68378342 CTGTTTTCTCAAAGGCAAAGTGG + Intergenic
1029092323 7:98057935-98057957 CTGAATCCTGAAAGGCAAAAAGG + Intergenic
1030352246 7:108502540-108502562 CTGGATCCACATAGCCAATTAGG + Exonic
1030939164 7:115623734-115623756 CTATATCCTCAGGGCCAATTGGG - Intergenic
1035749004 8:1982514-1982536 GTGTTTCCTCAAAGGCCAGTGGG - Intronic
1037536672 8:19831039-19831061 CAGTATACTCAAAGGAAAATAGG - Intronic
1037573160 8:20175928-20175950 CTCTATTCTCAAAGGACATTGGG - Intronic
1039143390 8:34418300-34418322 CTGTATAGTCAAAAGCAATTCGG - Intergenic
1040994275 8:53386386-53386408 CTCTATCCACAAAGAAAATTTGG - Intergenic
1046195304 8:110856044-110856066 CTGAATCCTCAAAAGTCATTGGG + Intergenic
1048197415 8:132343561-132343583 CTGTCTCATCAAAGGCCATCTGG + Intronic
1049713436 8:144078094-144078116 CTGCATCCTCAAAGGGAAAAGGG + Intergenic
1051174447 9:14348355-14348377 CTGTAAACTCACAGCCAATTTGG - Intronic
1051349636 9:16186752-16186774 CTGTCTCCTCAAAGGCCTGTTGG - Intergenic
1052223904 9:26060780-26060802 CAGTAACCTCAAAGGCTATAAGG - Intergenic
1052874949 9:33551765-33551787 CTCTATCCTCAGAGTTAATTGGG + Intronic
1053227744 9:36375526-36375548 CTGTATCCTCAAAGGCAATTAGG - Intronic
1053501071 9:38592558-38592580 CTCTATCCTCAGAGTTAATTGGG - Intergenic
1053512896 9:38704162-38704184 CTGTTTCCTCAACTGCAAATGGG + Intergenic
1053660122 9:40268244-40268266 CTTTATCCTCAGAGTTAATTGGG + Intronic
1053910496 9:42897599-42897621 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1054361116 9:64120954-64120976 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1054372255 9:64414548-64414570 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1054524476 9:66107973-66107995 CTTTATCCTCAGAGTTAATTGGG - Intronic
1054679873 9:67904245-67904267 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1058214098 9:102211383-102211405 CTGAAGCCTCTAATGCAATTAGG - Intergenic
1058989752 9:110243375-110243397 CTGTTTCCTCACAGGTAAATGGG + Intergenic
1203693479 Un_GL000214v1:68510-68532 CTTTATCCTCAGAGTTAATTGGG - Intergenic
1203706071 Un_KI270742v1:49021-49043 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1203557929 Un_KI270744v1:16877-16899 CTTTATCCTCAGAGTTAATTGGG - Intergenic
1203642794 Un_KI270751v1:35553-35575 CTTTATCCTCAGAGTTAATTGGG + Intergenic
1187768602 X:22670455-22670477 CTGTGTCCTCAAAGGTAACATGG - Intergenic
1188638872 X:32472910-32472932 CTGTTTTCTCAATTGCAATTGGG - Intronic
1190984609 X:55489359-55489381 CTGTATCCTAAAAAACACTTGGG + Intergenic
1193159853 X:78216033-78216055 TTGTATCCTAAAGGGCAATGCGG - Intergenic
1196306251 X:114106706-114106728 CTGTATCCTCCCAGGAAACTGGG - Intergenic
1201468079 Y:14306926-14306948 CTGAATCCTAATAGGCTATTGGG - Intergenic