ID: 1053229396

View in Genome Browser
Species Human (GRCh38)
Location 9:36393818-36393840
Sequence GTTGTGAGAAGGCATGCGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053229392_1053229396 14 Left 1053229392 9:36393781-36393803 CCCAAGAGATTCTCTTGCCAATT 0: 1
1: 0
2: 0
3: 15
4: 187
Right 1053229396 9:36393818-36393840 GTTGTGAGAAGGCATGCGAAAGG No data
1053229391_1053229396 18 Left 1053229391 9:36393777-36393799 CCTTCCCAAGAGATTCTCTTGCC 0: 1
1: 1
2: 4
3: 58
4: 787
Right 1053229396 9:36393818-36393840 GTTGTGAGAAGGCATGCGAAAGG No data
1053229394_1053229396 -3 Left 1053229394 9:36393798-36393820 CCAATTCTTCAGACTAAGATGTT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1053229396 9:36393818-36393840 GTTGTGAGAAGGCATGCGAAAGG No data
1053229393_1053229396 13 Left 1053229393 9:36393782-36393804 CCAAGAGATTCTCTTGCCAATTC 0: 1
1: 0
2: 1
3: 19
4: 163
Right 1053229396 9:36393818-36393840 GTTGTGAGAAGGCATGCGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053229396 Original CRISPR GTTGTGAGAAGGCATGCGAA AGG Intronic
No off target data available for this crispr