ID: 1053230162

View in Genome Browser
Species Human (GRCh38)
Location 9:36401120-36401142
Sequence AAAAGGGAGGAGCGCTCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053230162_1053230176 27 Left 1053230162 9:36401120-36401142 CCACCGGAGCGCTCCTCCCTTTT 0: 1
1: 0
2: 1
3: 6
4: 80
Right 1053230176 9:36401170-36401192 CCCCCTTTGTTTCCACCCCGAGG 0: 1
1: 0
2: 0
3: 8
4: 105
1053230162_1053230180 29 Left 1053230162 9:36401120-36401142 CCACCGGAGCGCTCCTCCCTTTT 0: 1
1: 0
2: 1
3: 6
4: 80
Right 1053230180 9:36401172-36401194 CCCTTTGTTTCCACCCCGAGGGG 0: 1
1: 0
2: 0
3: 9
4: 85
1053230162_1053230178 28 Left 1053230162 9:36401120-36401142 CCACCGGAGCGCTCCTCCCTTTT 0: 1
1: 0
2: 1
3: 6
4: 80
Right 1053230178 9:36401171-36401193 CCCCTTTGTTTCCACCCCGAGGG 0: 1
1: 0
2: 0
3: 8
4: 106
1053230162_1053230182 30 Left 1053230162 9:36401120-36401142 CCACCGGAGCGCTCCTCCCTTTT 0: 1
1: 0
2: 1
3: 6
4: 80
Right 1053230182 9:36401173-36401195 CCTTTGTTTCCACCCCGAGGGGG 0: 1
1: 0
2: 0
3: 12
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053230162 Original CRISPR AAAAGGGAGGAGCGCTCCGG TGG (reversed) Intronic