ID: 1053231609

View in Genome Browser
Species Human (GRCh38)
Location 9:36415156-36415178
Sequence TTGGTGTTGTTGAGGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 1, 2: 5, 3: 46, 4: 394}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053231609_1053231614 21 Left 1053231609 9:36415156-36415178 CCCTTCTTCCTCAACAACACCAA 0: 1
1: 1
2: 5
3: 46
4: 394
Right 1053231614 9:36415200-36415222 TAACATAATCTCAAACTTATTGG No data
1053231609_1053231615 24 Left 1053231609 9:36415156-36415178 CCCTTCTTCCTCAACAACACCAA 0: 1
1: 1
2: 5
3: 46
4: 394
Right 1053231615 9:36415203-36415225 CATAATCTCAAACTTATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053231609 Original CRISPR TTGGTGTTGTTGAGGAAGAA GGG (reversed) Intronic
901372895 1:8815894-8815916 CTGTTGTTGTTGAGGTCGAAGGG - Intronic
901896720 1:12319869-12319891 TTGAACTTCTTGAGGAAGAAAGG - Intronic
904075978 1:27842863-27842885 TTTTTGTTGTTGCTGAAGAAAGG - Intronic
904955163 1:34277145-34277167 TTGGTGTTCTGAAGGAAGATTGG + Intergenic
905391473 1:37638549-37638571 TGAGTGTTGATGAGGCAGAAAGG + Intergenic
905949023 1:41930041-41930063 TTGAAGATGATGAGGAAGAAGGG - Intronic
905987142 1:42295984-42296006 TTGGTGTGGTTGTGGAGAAAAGG - Intronic
906502866 1:46354548-46354570 TTAGAGTGGTTGAGGCAGAATGG - Intronic
906902576 1:49852121-49852143 TTGTTGTTGTTAGGGTAGAAGGG - Intronic
907358820 1:53898180-53898202 TTGGGGTGGGTGAGGAAGAGGGG + Intronic
907656514 1:56348151-56348173 TTGGTGAGGTTGAAGAGGAAAGG + Intergenic
907670346 1:56469128-56469150 TTGGTGTGGATGTGGAAAAAAGG + Intergenic
908020189 1:59890894-59890916 GTGGTATTGTGGAGGAAGCATGG - Intergenic
909579033 1:77211592-77211614 TTGTTTTTGTTGAGGATGTAGGG - Intronic
909594923 1:77395945-77395967 TTGATCCTGTTGAGTAAGAATGG - Intronic
911162824 1:94698667-94698689 AGGGTATTGGTGAGGAAGAACGG - Intergenic
911209042 1:95120342-95120364 TTTTTCTTGTTGAGGATGAAAGG + Intronic
913199085 1:116481866-116481888 TTGGTGTTATTGAAGGAGAGAGG + Intergenic
913241337 1:116832608-116832630 TTGCTGATGTAAAGGAAGAAAGG - Intergenic
913312033 1:117509451-117509473 TCGTTGTTGTTAAGGAAGCAAGG + Intronic
913519842 1:119634339-119634361 TTGGTGTTGTTGATGAAGAATGG + Intronic
914095479 1:144540757-144540779 TTGTTGTTGTTGAAGCAGAATGG + Intergenic
914303046 1:146393139-146393161 TTGTTGTTGTTGAAGCAGAATGG - Intergenic
914450767 1:147789472-147789494 ATGTTGATGTTGATGAAGAAGGG + Intergenic
914516684 1:148380079-148380101 TTGTTGTTGTTGAAGCAGAATGG + Intergenic
915052078 1:153085556-153085578 TTGGTGTTGCTGAAAGAGAAGGG + Intergenic
915292957 1:154898568-154898590 TTGCTGTGGATGAGGAGGAAAGG - Intergenic
915681094 1:157582698-157582720 TTGATATTGTTGAGGAGGGAAGG - Intronic
915893160 1:159790071-159790093 TTTGTTTTGTTGAGGTAGCAGGG + Intergenic
915984048 1:160445690-160445712 TTGGTGTTTGTGAGTAACAACGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918013649 1:180611213-180611235 CTGCTGTTGCTGGGGAAGAAAGG - Intergenic
920364630 1:205441579-205441601 TTGGGGTTGTTAAGGAAGGGAGG - Intronic
921197161 1:212769148-212769170 TGGGTGTTGTAGAGGGAGAAGGG + Intronic
922244615 1:223783392-223783414 CTGCTGTTGGTGAGGAAGTAAGG - Intronic
922971827 1:229748404-229748426 TTGGTGATGATGAGGAGAAAAGG + Intergenic
1067401226 10:45975637-45975659 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067596510 10:47563556-47563578 TTGGGGTGGGTGAGAAAGAAGGG - Intergenic
1067869578 10:49945215-49945237 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1068591272 10:58855492-58855514 TTGTTGTTGTTGAGACAGAGTGG + Intergenic
1069509823 10:69033815-69033837 TTTGTGAGGTTGATGAAGAAAGG - Intergenic
1069641618 10:69959864-69959886 TTTGCGTTGTCTAGGAAGAAAGG - Intronic
1070127848 10:73636188-73636210 ATGGTATAGCTGAGGAAGAAGGG - Intronic
1070139864 10:73731126-73731148 TTGGGGTAGGTGAGAAAGAAGGG - Intergenic
1070218884 10:74419189-74419211 CTGTTGTTGGGGAGGAAGAATGG - Intronic
1070572996 10:77655634-77655656 TGGGTGTTGTGGAGGAGAAAGGG - Intergenic
1071458633 10:85870629-85870651 TTGGTGGTGCTGTGGAAGGAAGG + Intronic
1071615949 10:87076682-87076704 TTGGGGTGGGTGAGAAAGAAGGG + Intronic
1072180900 10:92978911-92978933 TTGGTAGTGTTCAGGAACAATGG + Intronic
1072362809 10:94676669-94676691 TTGGGGCTGTTGAGCAAAAAGGG - Intergenic
1072430055 10:95363103-95363125 ATTGTTTTGTGGAGGAAGAAAGG - Intronic
1072615190 10:97044391-97044413 TTGTTGTTGTTTAGGGAGACAGG - Intronic
1073300478 10:102468181-102468203 TTGGTATTGATAAGGAAGACGGG - Intronic
1073507030 10:104004726-104004748 TGGGTGTTGATATGGAAGAAAGG - Intronic
1073696371 10:105873820-105873842 TTGGTAAGGGTGAGGAAGAAAGG - Intergenic
1073835169 10:107432993-107433015 GTGTTGTTTTTGAAGAAGAAAGG - Intergenic
1074413328 10:113246277-113246299 TTGGGGTGGTAGAGGAATAAGGG + Intergenic
1074557625 10:114506496-114506518 TTGGTGAAGTTGAGGAGAAAAGG - Intronic
1074986127 10:118661519-118661541 GTGGTGTTCCTGAGGAAGAAGGG - Intergenic
1076985486 11:233120-233142 TTGGGGTTGTGAAAGAAGAATGG + Exonic
1077679631 11:4226850-4226872 TTGGTGAAGTTGTGGAACAATGG + Intergenic
1077681855 11:4249057-4249079 TTGGTGAAGTTGTGGAACAATGG - Intergenic
1077689048 11:4323426-4323448 TTGGTGAAGTTGTGGAACAATGG + Intergenic
1077909264 11:6559673-6559695 TTGTTGCTTTTGTGGAAGAAAGG - Intronic
1079992166 11:27257570-27257592 TTGCTTTTGATGAGGAGGAATGG - Intergenic
1081199511 11:40199389-40199411 TTGTGGTTGTTGGGGAAGGAGGG + Intronic
1082883927 11:58064669-58064691 TTGCTGTGGCTGAGGCAGAAGGG - Intronic
1082902209 11:58267236-58267258 GAGGTGGTGATGAGGAAGAAAGG + Exonic
1083009323 11:59381218-59381240 TTGGTATTCCTGAGGAAAAAAGG - Intergenic
1083283011 11:61639046-61639068 TTGGTGTTATGGACAAAGAAAGG + Intergenic
1083447274 11:62716788-62716810 TTGTTGTTGTTGAAGAATTATGG + Intronic
1085669883 11:78453206-78453228 TTGGTTTTGTTAAGGAATAGAGG - Intronic
1085849928 11:80108287-80108309 TTAGTATTCTTGAGGAAGATAGG + Intergenic
1085953874 11:81367445-81367467 TTGTTCTTGTTGAAGAATAATGG - Intergenic
1085971310 11:81594649-81594671 TTGTTGTTGTTGTTAAAGAAAGG + Intergenic
1086207877 11:84281872-84281894 TTGGTGATGATGTGGAAGATTGG + Intronic
1086645758 11:89218028-89218050 TTGGTGTTGTTCAGCATGGAGGG - Intronic
1087128414 11:94648161-94648183 GTGGTGTTGGTGAGGGAGGAGGG + Intergenic
1087303447 11:96461431-96461453 TTAGAGTGGTTGGGGAAGAAGGG + Intronic
1087883340 11:103446059-103446081 TTGTTGTTGTTTAGGGAGGAGGG + Intronic
1088011915 11:105014006-105014028 TTGGTGTAATTCAGAAAGAAAGG - Intronic
1088397126 11:109381472-109381494 GTGGTGTTGGGGAGCAAGAAAGG + Intergenic
1088737597 11:112740475-112740497 TTGGTGTTTGTGAAGGAGAATGG + Intergenic
1089702353 11:120253171-120253193 TTGGTGCTGTTGAGTACGCATGG - Intronic
1090694585 11:129225683-129225705 TTGTTGTTGTTGTTGAAGACTGG - Intronic
1091087128 11:132732373-132732395 GTGGTGTTGTTAAGGGAGAAAGG + Intronic
1091212019 11:133870009-133870031 TTGGTGTTGTTGTTGAGGCAAGG + Intergenic
1091659440 12:2372573-2372595 TTGGTAATGTGGAGGATGAAAGG - Intronic
1092929652 12:13303866-13303888 TTAATTTTGGTGAGGAAGAAAGG + Intergenic
1093261589 12:16944326-16944348 TTTGTGTTGTTGAGATAAAATGG - Intergenic
1093388856 12:18592759-18592781 TTTATGTTGATGAGGAAAAACGG + Intronic
1093393841 12:18656121-18656143 TTGCTGTTTTTGTGGAAGAATGG - Intergenic
1093654502 12:21678956-21678978 TAAGTGTGGTTTAGGAAGAAAGG - Intronic
1095178584 12:39121658-39121680 TTGGTGTTCCCAAGGAAGAAGGG - Intergenic
1095722045 12:45411599-45411621 GTGGTGTTGTTAAGGAATATGGG - Intronic
1095852181 12:46822655-46822677 TAGGTTTTGTATAGGAAGAATGG + Intronic
1096890083 12:54760690-54760712 TTTGTGTTTTTGTGGAAGCAGGG + Intergenic
1097986932 12:65793472-65793494 TTTACCTTGTTGAGGAAGAATGG + Intergenic
1098905678 12:76159804-76159826 TTGGTATCATTTAGGAAGAATGG - Intergenic
1099619668 12:84985629-84985651 TTGGTGATGTTGAAGGAAAATGG - Intergenic
1099832650 12:87865046-87865068 TTGTTGTTTCTGAGGAAGAAAGG - Intergenic
1100533627 12:95484051-95484073 TTCGTAGTGTTGAGGAAGAAAGG + Intronic
1100927959 12:99571233-99571255 TAAGGGTTGTGGAGGAAGAATGG - Intronic
1101868130 12:108538321-108538343 TTGTTGTTGTTGAGGAAACCAGG - Intronic
1102710223 12:114919482-114919504 TTAGTGTCTTTCAGGAAGAAGGG - Intergenic
1102891107 12:116559244-116559266 TCGCTGTTGCTGAGAAAGAAAGG - Intergenic
1103549430 12:121726089-121726111 TTGCTGTGGGTTAGGAAGAAGGG + Intronic
1105282208 13:18972831-18972853 TTGGTGATGATGTGGAAAAAAGG + Intergenic
1105397246 13:20048994-20049016 TTGGTGTTGGTAAGGAATGATGG + Intronic
1105846277 13:24297043-24297065 TTGTTGTTGTTTAGAGAGAAGGG + Intronic
1106763898 13:32894490-32894512 TTGGGGTAGCTGAGGCAGAATGG + Intergenic
1106775916 13:33009519-33009541 TGGGTGGGGTAGAGGAAGAAAGG - Intergenic
1107110349 13:36690967-36690989 TTGTTGTTGTTGTGGAAAACTGG - Intronic
1108772225 13:53717577-53717599 TTGTTGTTGTTTAAAAAGAAAGG + Intergenic
1109201207 13:59433805-59433827 TTGGTGTTACCAAGGAAGAAGGG - Intergenic
1110375843 13:74793206-74793228 TTGGTGTTCCTGAGGGAGAAGGG - Intergenic
1110386563 13:74918861-74918883 TTGGGAGTGGTGAGGAAGAAGGG + Intergenic
1110449795 13:75628810-75628832 TCTGTGTTGTAAAGGAAGAAGGG - Intronic
1110652535 13:77958977-77958999 GTGGTGTTGTTGGGAGAGAAGGG + Intergenic
1112249064 13:97762197-97762219 TTGTTGTTGTTGTTGAAAAATGG - Intergenic
1112858176 13:103796845-103796867 TTGGTTTTGTTTTTGAAGAAAGG - Intergenic
1113029062 13:105974167-105974189 TTGCTTTTGTTCAAGAAGAATGG - Intergenic
1113078150 13:106488714-106488736 TTGTTGTTGTTGCTGATGAAGGG + Intergenic
1113141132 13:107150672-107150694 TTGTTGTTGTTGAGTTAAAAGGG + Intergenic
1114954443 14:27799801-27799823 TTGGTGATGTTTACCAAGAAAGG + Intergenic
1116990205 14:51268106-51268128 TTGGTGTACTTCAGGAAGACAGG - Intergenic
1117091853 14:52259127-52259149 ATTGTGTTGATAAGGAAGAAAGG - Intergenic
1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1117524869 14:56590037-56590059 TTTTTGTAGTTGAAGAAGAATGG + Intronic
1117881001 14:60313469-60313491 GTGGTGTTGTTGAGAAACAAGGG - Intergenic
1119220291 14:72900972-72900994 CTGGTGTTAGTGAGGGAGAAGGG - Intergenic
1119575535 14:75718010-75718032 TGGGTGTTGTAGAGGTGGAAAGG + Intronic
1120647271 14:87088975-87088997 TTGGTTCTCTGGAGGAAGAAGGG - Intergenic
1124521839 15:30411505-30411527 TTGCAGTTGATGGGGAAGAAAGG - Intronic
1124536825 15:30554714-30554736 TTGCAGTTGATGGGGAAGAAAGG + Intronic
1124761827 15:32452877-32452899 TTGCAGTTGATGGGGAAGAAAGG - Intronic
1124776802 15:32596191-32596213 TTGCAGTTGATGGGGAAGAAAGG + Intronic
1126410140 15:48364983-48365005 TTGGTGTTGATGAAGATGACAGG - Intergenic
1126678545 15:51182773-51182795 CTTTTGTTGGTGAGGAAGAAAGG + Intergenic
1127090137 15:55458568-55458590 TTGGTGCTCCTGAGGAAGAAGGG + Intronic
1127573828 15:60271287-60271309 TTAGTGTTCCTGAGAAAGAAGGG - Intergenic
1127664293 15:61129871-61129893 TTGGTCTTTTTGATTAAGAAAGG - Intronic
1128101101 15:65000553-65000575 TTGGTGGTGGTGTGGAAGATAGG - Intergenic
1129948086 15:79559670-79559692 CTGGTGTTGATGATGATGAAGGG + Intergenic
1132109117 15:99089294-99089316 TTGGTGTTGCTGTGGAATAAAGG - Intergenic
1132271718 15:100532171-100532193 TGGGTGTAGATGGGGAAGAAGGG + Intronic
1132412726 15:101596646-101596668 TTGGTGTTCCAGAGGAAGAAGGG - Intergenic
1134329243 16:13235368-13235390 TTGCTGTTGGTGATGAAGTATGG - Exonic
1134881578 16:17749008-17749030 TTGGTGTTGTGGTTGTAGAAGGG - Intergenic
1135601185 16:23784894-23784916 TTGGTGTTGCTGCAGTAGAAGGG + Intergenic
1135609033 16:23848674-23848696 TTGGTGTTTTGGAGAAAGAAAGG + Intronic
1135784190 16:25333496-25333518 TTGGTGGTGGTAAGAAAGAAGGG - Intergenic
1137792815 16:51189050-51189072 GTGGTGGTGTTGAGGCGGAAAGG + Intergenic
1138220432 16:55245760-55245782 TTGGTCTTGTCTGGGAAGAATGG + Intergenic
1139903113 16:70343578-70343600 TTGTTGTTGTTGGGGGAGACAGG - Intronic
1141030821 16:80586848-80586870 TGGGTGTTGTTGAAGAAGGGGGG + Intergenic
1141575021 16:84958290-84958312 TTGCTGTAGTTGAGGCAGAAAGG + Intergenic
1143004305 17:3818027-3818049 TAGTTATTGTTGAGAAAGAATGG + Intronic
1144288550 17:13803675-13803697 TTGGTGTTATTAAAGAAGGAAGG + Intergenic
1144522654 17:15964211-15964233 TTGTTGTTTTTGTGTAAGAATGG + Intronic
1145943585 17:28757458-28757480 TTGTTTTTGTTGAGGGGGAAAGG + Exonic
1146821519 17:35986603-35986625 ATGGTGATGAGGAGGAAGAAGGG + Exonic
1148931755 17:51132605-51132627 TTTATGTTTTTGAGGAATAATGG - Intergenic
1149654029 17:58300997-58301019 CTGGGGTTGTGGAGGAAGATGGG - Intergenic
1150097255 17:62388323-62388345 TTGGTCTTGTGAGGGAAGAAAGG + Intronic
1153951749 18:10063604-10063626 TTGTTTTTGTTAAAGAAGAATGG + Intergenic
1154069575 18:11141276-11141298 GTGGTGTATTTAAGGAAGAATGG + Intronic
1155001801 18:21694968-21694990 GTTCTGTTGCTGAGGAAGAAGGG - Intronic
1155269745 18:24128514-24128536 ATGGAGCTGATGAGGAAGAAAGG - Intronic
1155522940 18:26687413-26687435 TTGGTGTTGAGGAAAAAGAAAGG + Intergenic
1156776008 18:40789823-40789845 TTGGTCTTGTTAAGGGTGAAGGG + Intergenic
1156879380 18:42058667-42058689 TTAGTGGTGTTGAAGAAAAAAGG - Intronic
1157541003 18:48506571-48506593 TTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1158377377 18:56886009-56886031 TTGGTGTTCCTGAGAAAGAAGGG + Intronic
1159094257 18:63884703-63884725 TTGGTGTTATAGAGGAGGAAAGG - Intronic
1159328661 18:66958466-66958488 ATGGTGTTATTGAGGTATAATGG - Intergenic
1159448418 18:68568689-68568711 TAGGTTTTGTTGGGGAAGAAAGG + Intergenic
1160058968 18:75512210-75512232 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1160059433 18:75515868-75515890 TTGGGGTGGGTGAGGAAGAGTGG + Intergenic
1162392338 19:10397064-10397086 TTGCTGATGTTGAGGAGGCAGGG - Intronic
1162584989 19:11553102-11553124 TTGCTTTTGTAGAGGAAGCAAGG - Exonic
1163695284 19:18760683-18760705 TGGATGTGGCTGAGGAAGAAAGG - Intronic
1165082925 19:33320566-33320588 TTGGTATTACTGAGGAGGAATGG + Intergenic
1165421557 19:35724571-35724593 TTGGGGTTGTAGAAGAAGAGGGG + Intronic
1166356247 19:42229271-42229293 TGGGTGGTGTTGAGCAAGGAAGG + Intergenic
1167759515 19:51436547-51436569 TTGGGCTTGTTGACAAAGAAAGG + Intergenic
926649917 2:15332039-15332061 TTGGCTTTGAAGAGGAAGAAAGG + Intronic
926855020 2:17246165-17246187 TTGTTGTTGTTGCTCAAGAAGGG - Intergenic
929516781 2:42610550-42610572 TGGCAGTTGTTGAGGAAAAACGG + Intronic
930335955 2:50046127-50046149 TTGAAGTTGGTGAGGAAGTAGGG + Intronic
930610920 2:53542472-53542494 TTGGTGTGGATGTGGCAGAAGGG - Intronic
930834973 2:55783427-55783449 TTGGTGAGGATGAGAAAGAAAGG + Intergenic
931192581 2:60019731-60019753 TTGATGTTGTAGTAGAAGAATGG - Intergenic
931533218 2:63241024-63241046 TTGGTGTTATTGAATAAGTATGG - Intronic
932647256 2:73516303-73516325 TTGGTGAGGTTGCAGAAGAAAGG + Intronic
934482868 2:94669491-94669513 TTGGTGATGTTTACCAAGAAAGG - Intergenic
934653430 2:96104939-96104961 TTGGTGTTGCTGAGTAGGATGGG - Intergenic
934715020 2:96538105-96538127 TTGGTGTGGCAGAGGTAGAAAGG + Intronic
934845999 2:97661654-97661676 TTGGTCTTGTTGAGCCAGCAAGG - Intronic
936471660 2:112804175-112804197 TTGGTGAGGATGTGGAAGAACGG + Intergenic
937605293 2:123793323-123793345 TTGATGTTGTTCAGAGAGAAGGG - Intergenic
938154469 2:128920883-128920905 GTGGTGTTTCTGAGGAGGAATGG + Intergenic
939132680 2:138256511-138256533 ATGGAGTTGTGGAGGAACAATGG + Intergenic
940389669 2:153117582-153117604 TTGGTGCAGTTGAGGTAGCATGG + Intergenic
940892225 2:159046313-159046335 TTGGTGGGTTTGAGGGAGAAGGG + Intronic
941015945 2:160356429-160356451 GTGGTGCTGATGAGGAAGCAAGG + Intronic
942119954 2:172766686-172766708 CTGTTGGTGTTGATGAAGAAAGG - Intronic
942358839 2:175149842-175149864 TTAGTGGTGTTGACTAAGAAAGG - Intronic
945952123 2:216049257-216049279 TTGGTGTTCCTGAGGAGGTAAGG - Exonic
946510232 2:220348132-220348154 TTGCAGTTGTTGAGGGAGCATGG + Intergenic
946661524 2:222005860-222005882 TTTGCCTTTTTGAGGAAGAAGGG + Intergenic
946992110 2:225345135-225345157 TTGGTGTGGATGTGGAGGAAAGG - Intergenic
947023532 2:225711056-225711078 TTGGTCTTGAGGTGGAAGAATGG + Intergenic
947323879 2:228953391-228953413 TTTGTGTGGTTGAGCAAGATCGG - Intronic
947972738 2:234337568-234337590 CTGGTGGTGTTGTGGAAGGAAGG + Intergenic
1168796834 20:615962-615984 TTTCTGTTAGTGAGGAAGAAGGG + Intergenic
1170870219 20:20199254-20199276 TTGTTGTTGTTGTTGAACAAAGG + Intronic
1173047074 20:39522728-39522750 TTGGTCTAGTTGAGGAGGCAGGG + Intergenic
1174189173 20:48728054-48728076 AGGGTGGTGTTGAGGAGGAATGG - Intronic
1174595454 20:51679787-51679809 TTGTTGTGGATGAGGAACAAAGG - Intronic
1174769899 20:53289449-53289471 TTGGTGTGGATGCGGTAGAAAGG - Intronic
1175488037 20:59359360-59359382 TTGGAGTTGTTGAGGGACATTGG + Intergenic
1177145832 21:17406185-17406207 TTGGTGTTGTCTGGGATGAATGG + Intergenic
1177390695 21:20466399-20466421 TTGTTGTTGTTCACTAAGAATGG - Intergenic
1177585469 21:23088480-23088502 TTGTTTGTGTTTAGGAAGAATGG + Intergenic
1178829284 21:36041631-36041653 TTGATGTTGTGGAGGACAAAAGG - Intronic
1179962048 21:44773056-44773078 TAGGTGTTGATGAGGTAGGAGGG - Intronic
1181612755 22:24029676-24029698 TTGGAGTAGCTGAGGAAGAGTGG + Intronic
1181948328 22:26536292-26536314 TGTGTGTTGTTGATGACGAAGGG + Exonic
1185127591 22:49020124-49020146 TGTGTGTGGGTGAGGAAGAAGGG - Intergenic
951366559 3:21790320-21790342 TAGATGGTGTTGAGGAAGAATGG + Intronic
951997291 3:28745231-28745253 TAGGTGTTATTAATGAAGAATGG - Intergenic
953570381 3:44066873-44066895 ATGGTCTTGTTGAAGAAGTAAGG - Intergenic
953822192 3:46216369-46216391 TTGGTGTGCCTGAGGAAGAAAGG + Intronic
954366610 3:50149836-50149858 TGGGTGTAGATGAGAAAGAAAGG + Intergenic
954642691 3:52111138-52111160 TTCATGATGTTGAGGAAGGAAGG - Intronic
955793698 3:62613383-62613405 CAGGTGTTTATGAGGAAGAAGGG + Intronic
956210342 3:66795760-66795782 TGGGTGTTGGTGGGGGAGAAAGG - Intergenic
956477474 3:69637660-69637682 TTGGTGAGGTTGAGGATAAAAGG - Intergenic
957629152 3:82696046-82696068 TTGTTGTTGTTGTGGAATACTGG - Intergenic
958501514 3:94915746-94915768 TTGTTGTTGTTGGGGGAGACAGG + Intergenic
958619691 3:96542121-96542143 TTGGTGAGGCTGTGGAAGAATGG + Intergenic
958631330 3:96686833-96686855 TTGGTGTTCTTGTGGCAGAGAGG + Intergenic
958792866 3:98671632-98671654 TGGGTGTTGTTGGGGAAGGGAGG + Intergenic
959461012 3:106625567-106625589 TTTGTCTTGCTGAGTAAGAAAGG - Intergenic
959945670 3:112123247-112123269 ATGGTGTTGTTCAGGATAAATGG + Exonic
960255899 3:115511340-115511362 TTGCTGGTTTTGAAGAAGAAAGG + Intergenic
960444350 3:117729577-117729599 TGGGGGTTGTTGAGGGAAAAGGG - Intergenic
960730056 3:120717360-120717382 ATTGTGTTATTGTGGAAGAATGG - Intronic
960926110 3:122795898-122795920 ATGGGGATGTTGAGGATGAAAGG + Intronic
961870122 3:129981369-129981391 TTGGTCTGGTTGAGGAAAGAAGG + Intergenic
962697430 3:137963854-137963876 TTGGTGCTGTTGAGGCAGGTAGG - Intergenic
963467892 3:145705281-145705303 GTGGTCTTGTTGAAGAAGATGGG + Intergenic
963817441 3:149847617-149847639 TTGGTCTTTTTGAGGTGGAATGG + Intronic
964075637 3:152688529-152688551 TTGGTGCTGTTGAGGGGGCATGG + Intergenic
965059846 3:163771810-163771832 TTGGTCTTAAAGAGGAAGAAGGG - Intergenic
965154167 3:165025377-165025399 CTGGTGTTCCTGAGGAAGAAGGG + Intronic
965550884 3:169963903-169963925 TTGTTGTTGTTGTTGAAGACAGG - Intergenic
966669242 3:182508544-182508566 TTCATGGTTTTGAGGAAGAAAGG - Intergenic
968347386 3:198021306-198021328 TTGGTGCCATTGATGAAGAAAGG + Intronic
968402600 4:311589-311611 TTTGTGTTCTTGAGGACAAAGGG + Intergenic
970531325 4:16988437-16988459 TCGGTCTTGCTGAGGGAGAAAGG + Intergenic
971062157 4:22984426-22984448 TTGAAGTTCTTGAGAAAGAATGG + Intergenic
971442870 4:26709044-26709066 TTGTTGTTGTTGTTGAAAAAGGG + Intronic
971573243 4:28241014-28241036 TTGTTGTTTCTGAGGAGGAATGG + Intergenic
971775230 4:30955186-30955208 TTGGTGCTCTTAAGGAAGACAGG + Intronic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972804051 4:42509356-42509378 GTAGAGCTGTTGAGGAAGAAGGG + Intronic
972887695 4:43512667-43512689 TTGGTGTTGTACATAAAGAATGG - Intergenic
972935800 4:44133479-44133501 TAGGTGTTGTTTTGGCAGAAGGG + Intergenic
973209190 4:47596787-47596809 TTGGTATTGTTGAAGAACATAGG + Intronic
973804436 4:54512197-54512219 TTGGTGTTCAGGAGGAAAAAAGG + Intergenic
974156689 4:58082643-58082665 AATGTGTAGTTGAGGAAGAAGGG + Intergenic
974501906 4:62716000-62716022 TTGTTGATTTTGAGGAAGAAAGG + Intergenic
975321663 4:73015416-73015438 CTGGTGTTCTGGAGGAAGAGTGG - Intergenic
976409561 4:84698026-84698048 TGTGTGTGGTTGAGGAGGAAGGG - Intronic
976465806 4:85367557-85367579 TTGGTATTGTAGAGGAAAAGGGG + Intergenic
976962973 4:91002365-91002387 CTGGTATTCCTGAGGAAGAAGGG - Intronic
977359431 4:95983978-95984000 TTGGAGCTGTTTAGGAAAAAAGG + Intergenic
977519403 4:98061803-98061825 TTGGTGAGGTTGTGGAAAAAAGG + Intronic
978157266 4:105504337-105504359 TTGGTGATGTTGAGTAAGTCTGG - Intergenic
978623403 4:110657144-110657166 TTGGTGTCTTGGAGGTAGAAGGG - Intergenic
979159880 4:117446934-117446956 TTGGTGTTCCTGAGAAAGAAGGG - Intergenic
980068045 4:128212834-128212856 TTGGTGTTGATAAGGATGTAGGG - Intronic
980314864 4:131185669-131185691 TTGGTGCTGTAGATGGAGAAAGG + Intergenic
982406433 4:155025313-155025335 TTGGGGTGGTTGAGGGTGAAGGG - Intergenic
982431977 4:155333149-155333171 TTGGTGAGGTTGTGGAAAAAAGG - Intergenic
982524140 4:156456365-156456387 CTGGTGAGGTTGAGGAAAAAAGG + Intergenic
983277416 4:165635514-165635536 TTGGTGCTGTTGTGGAGGCATGG + Intergenic
983679930 4:170341730-170341752 TTGGTGAGGTTGAGGAGAAAAGG - Intergenic
984397834 4:179223804-179223826 TGGGTGTTTTAGAGGGAGAATGG - Intergenic
984592992 4:181637146-181637168 TAGGAGTTGCTGAGGAAGAAGGG - Intergenic
984781949 4:183533960-183533982 TGGGGGTTGTGGGGGAAGAACGG + Intergenic
985909804 5:2869933-2869955 TTGGTGTTGGTGAGACAGACAGG + Intergenic
986200400 5:5573754-5573776 TGATTGTTGTTGAGGAAGAGAGG + Intergenic
986871581 5:12053623-12053645 TTGCTGTTGTTGAAGCAGAATGG + Intergenic
987419726 5:17705030-17705052 TTGGTTTTGTTGAAAAAGAGGGG + Intergenic
987903579 5:24047386-24047408 TTGGTTTTCTTGAGCAACAAAGG - Intronic
988104302 5:26723789-26723811 TTGAGATTGTTGAGGAAGAAGGG - Intergenic
988651434 5:33156183-33156205 CTGGTGAGGTTGAGGAATAAAGG - Intergenic
988970290 5:36460057-36460079 TTGGTGTGGCTGAGGAAGAAAGG + Intergenic
989266387 5:39479519-39479541 GTGATTGTGTTGAGGAAGAAAGG - Intergenic
989409259 5:41098824-41098846 TTTGTGTAGATGAGGCAGAATGG + Intergenic
990074112 5:51821385-51821407 TTAGTGTTGCTGTGAAAGAAAGG + Intergenic
990379716 5:55210907-55210929 TTGGTGTTGATGGGGACGATGGG + Intergenic
991115511 5:62950138-62950160 AAGATGTTATTGAGGAAGAAAGG - Intergenic
991228477 5:64301172-64301194 TTGCTGTTGTTCAGTAGGAAGGG - Intronic
991998603 5:72413371-72413393 AAGGAGTTGTTAAGGAAGAAGGG + Intergenic
993161293 5:84294890-84294912 TAGTTGTTGTTGATGAAGTAGGG - Intronic
993772980 5:91954361-91954383 TTTGTGTTGTTGAGTAACATAGG + Intergenic
993949822 5:94160749-94160771 TCTGTGTTATTGAGGGAGAAGGG - Intronic
994015668 5:94962151-94962173 TTGGTGTGGATGGGGTAGAAAGG + Intronic
994044461 5:95292203-95292225 TGGGGCTTTTTGAGGAAGAAAGG + Intergenic
994208915 5:97066251-97066273 TTGGAGTTGGTAAGGCAGAAAGG + Intergenic
994224107 5:97232307-97232329 TTGGTGGTTTTGAGACAGAAGGG + Intergenic
994519756 5:100818071-100818093 TTGGTGGTGATGGGAAAGAAAGG + Intronic
995767492 5:115634848-115634870 TTGGTGTTGGTGGGGTAGGAGGG - Intergenic
995794980 5:115931527-115931549 TTGGACATGTTGAGTAAGAAAGG + Intergenic
996195097 5:120595455-120595477 TTGGTGTGGTTGTGGAGAAAAGG + Intronic
996427345 5:123329258-123329280 TTGGTGTTCCTGAGGAAGAAGGG - Intergenic
997196129 5:131981124-131981146 TTGGTGTGGGTGGGGGAGAAAGG - Intronic
997487279 5:134242060-134242082 TTGGTGTTGTTGAAGATAATGGG + Intergenic
999709398 5:154303086-154303108 GGGGTGTTGTTTAGGCAGAAGGG - Intronic
999723770 5:154418171-154418193 TTGGTGGTGTTGGGAAAGCAGGG + Exonic
999821553 5:155233861-155233883 GGGGAGTTGTAGAGGAAGAAAGG + Intergenic
1000991581 5:167916914-167916936 TTGGTGTTGTTGCTTAAGCAGGG + Intronic
1001553122 5:172618646-172618668 TTTGCGTTGTTGAGGATGAAGGG - Intergenic
1002349124 5:178570589-178570611 TTGATGTTGTTTAGGCAGAATGG - Intronic
1002830341 6:814832-814854 TTGGTGAGTTTGGGGAAGAATGG - Intergenic
1003081168 6:3023000-3023022 CTGGGGGCGTTGAGGAAGAAGGG - Intergenic
1005168594 6:22955320-22955342 TTCTTGTTGCTGAGGGAGAAGGG + Intergenic
1005588735 6:27302655-27302677 TTGTTGTTGTTGAGGAAATGGGG - Intronic
1006809095 6:36808421-36808443 TGGGTGATGAGGAGGAAGAAGGG - Intronic
1006936650 6:37723406-37723428 TTTGTGTGGTGGAGGAAGGAAGG - Intergenic
1007115174 6:39338301-39338323 TTGATATTGCTGTGGAAGAAAGG + Intronic
1007373015 6:41439211-41439233 TTTGGGGTGTTGAGGAAGCAGGG + Intergenic
1007490606 6:42218655-42218677 TTGGTGTGGGGAAGGAAGAAAGG - Intergenic
1007517536 6:42425176-42425198 TTATTGTTTTTGAGGAAGCATGG - Intronic
1007585728 6:42988100-42988122 TTGGAGGTGGGGAGGAAGAAAGG - Intronic
1007737779 6:43992520-43992542 GTGGTGTTGGTGATGAAGATGGG + Intergenic
1008021287 6:46580856-46580878 TTGGTGAGGTTGAGGAGAAAAGG + Intronic
1008182826 6:48354223-48354245 TTGATGTTTTTGAGGAACAATGG + Intergenic
1008436014 6:51477540-51477562 TTGTTGTTGTTGTGGAAGAAGGG - Intergenic
1008781303 6:55108962-55108984 TCGGTGCTGTTGAGGGAGCATGG + Intronic
1009392106 6:63156666-63156688 TTGGTGTTCCTGAAAAAGAAGGG + Intergenic
1009690486 6:67025904-67025926 TTGGAGTTGGTGAGGATGTATGG - Intergenic
1010378978 6:75205575-75205597 TTGGGGTTTTTGAGGGAGAGGGG - Intronic
1011113220 6:83861135-83861157 TTGGTATTTTTAACGAAGAAGGG - Intronic
1011578016 6:88826256-88826278 TTGGTGATGGTGTTGAAGAAGGG - Intronic
1014112280 6:117632139-117632161 ATGGTGTAGCTAAGGAAGAAAGG + Intergenic
1014734572 6:125077471-125077493 TATGTGTTGTTGAGGAAGAGGGG - Intronic
1015085014 6:129280033-129280055 TTGATGTTGTTGCGGAAAACAGG - Intronic
1015184483 6:130398618-130398640 TTGGTGAGGTTGTGGAATAAAGG - Intronic
1015231769 6:130923060-130923082 TTGGAGTTGTTCAGTAAGAAGGG - Intronic
1015333905 6:132012827-132012849 TTGGTGTTTTAGCTGAAGAATGG + Intergenic
1015659316 6:135557513-135557535 TTGGTGTAGTTTAGCAGGAAAGG + Intergenic
1016176069 6:141078881-141078903 TTGGTGTTCCTGAGGAATAATGG + Intergenic
1016351616 6:143175417-143175439 TTGGTGTTCCTGAAGAAGAAGGG - Intronic
1017846378 6:158262061-158262083 ATTCTGTTGGTGAGGAAGAAAGG + Intronic
1020555481 7:9664593-9664615 TCGGTGTAAGTGAGGAAGAAAGG + Intergenic
1020748867 7:12113326-12113348 TTGATTTTGTTGATGAAGTACGG - Intergenic
1020985988 7:15134753-15134775 TTGGGGTTTTTGAGGAAGGAAGG + Intergenic
1021717767 7:23474552-23474574 TTGGTTTTGTTGAGGTTGAGGGG + Intergenic
1022328647 7:29356557-29356579 TTGTTGTTGTTGTGTAAAAATGG + Intronic
1023529937 7:41142380-41142402 TTGGTGTTATTGAGTTATAATGG + Intergenic
1023736697 7:43241914-43241936 TGGGGGGTGTGGAGGAAGAAGGG + Intronic
1024367163 7:48534619-48534641 TTGGTTTTCCTGAGGAAGAAGGG - Intronic
1027983804 7:85259379-85259401 TTGGTTGTGTTGAAGAACAAAGG + Intergenic
1028836729 7:95382791-95382813 TTGGGATAGTTTAGGAAGAATGG - Intronic
1029618447 7:101674896-101674918 TTGGTTTTCTTCTGGAAGAAAGG + Intergenic
1030547461 7:110914947-110914969 TTGGTGATGGTGAGGAGAAAAGG + Intronic
1032015945 7:128380542-128380564 TTGGTGTTGGTGCAGGAGAAGGG - Intergenic
1032737185 7:134703250-134703272 TTGTTATTATTGAGGAAGACAGG + Intergenic
1033239341 7:139664221-139664243 TTATTGTAGTTGAGAAAGAAGGG - Intronic
1033367703 7:140684092-140684114 TTGGTGTTGGAGAGGCAGAGGGG + Intronic
1034393513 7:150803122-150803144 TTGGTGTTGTTTAAAAAGGAAGG + Intronic
1034406515 7:150906946-150906968 TTGGTGTTGGTGTGGAGAAAAGG + Intergenic
1035208046 7:157307630-157307652 TTGGGGTGGTCCAGGAAGAATGG - Intergenic
1035914833 8:3607822-3607844 CTGGTGTTGGTGTGGCAGAAAGG + Intronic
1037659955 8:20917989-20918011 TTGGTGGGGTTGAGGAGGACAGG - Intergenic
1038428420 8:27480571-27480593 ATGGTTTTATTGAGGAACAACGG + Intergenic
1038678981 8:29649289-29649311 TTGCTGGTGGTGAGGAAGATGGG - Intergenic
1038765913 8:30427478-30427500 TTCCTGTAGTGGAGGAAGAATGG - Intronic
1041480864 8:58318429-58318451 TTGGGGTTGGTGGGGAAGAAGGG + Intergenic
1041987613 8:63944272-63944294 TTGGGGTTCTTGAAGAAGGAAGG - Intergenic
1041990951 8:63991037-63991059 TTGTTATTGTTGTGGGAGAAAGG + Intergenic
1042078518 8:65022923-65022945 TTGGTGATGGTGTGGAGGAAAGG + Intergenic
1042659938 8:71143152-71143174 TTGCTGGTCTTGAGGTAGAAAGG - Intergenic
1042968435 8:74381013-74381035 TTGGAGTAGGTGAGGGAGAAAGG + Intronic
1043247174 8:78019051-78019073 TGTGTGGAGTTGAGGAAGAAGGG - Intergenic
1043541787 8:81271650-81271672 ATGGTTTTCTTGAGGAACAAGGG + Intergenic
1045147018 8:99357182-99357204 TAGGTGAGGTAGAGGAAGAAAGG - Intronic
1045671022 8:104553387-104553409 TTGGTGCTGTTGGAGAAGCACGG + Intronic
1046235333 8:111416874-111416896 TTGTTGTTGTTGTTGATGAAGGG + Intergenic
1046355113 8:113072928-113072950 TTGTTATTGTTGAGTAAGGATGG - Intronic
1047629095 8:126686750-126686772 TTGGTGAGGATGTGGAAGAATGG - Intergenic
1048819818 8:138370279-138370301 ATGCTGTTGTTCAGGATGAATGG + Intronic
1049600525 8:143505390-143505412 TCGGGGTTGTTTAGGCAGAAAGG - Intronic
1050753295 9:8967154-8967176 TTGGTGAGGTTGTGGAAAAAAGG + Intronic
1051184439 9:14443451-14443473 TAGGTGATGTGGAAGAAGAAGGG - Intergenic
1051402102 9:16694165-16694187 TTGGTGTTGTTTAGCAAGGGAGG - Intronic
1051707307 9:19894102-19894124 TTTATGTTTTTGAGGAAGAAGGG + Intergenic
1053178651 9:35948764-35948786 TTGATGTTTTTGAGGAATACAGG + Intergenic
1053231609 9:36415156-36415178 TTGGTGTTGTTGAGGAAGAAGGG - Intronic
1053507656 9:38657470-38657492 ATGTTGTTTTTGGGGAAGAATGG + Intergenic
1053674962 9:40415230-40415252 TTGGTGATGTTTACCAAGAAAGG + Intergenic
1053924753 9:43041589-43041611 TTGGTGATGTTTACCAAGAAAGG + Intergenic
1054288238 9:63253762-63253784 TTGGTGATGTTTACCAAGAAAGG + Intergenic
1054386064 9:64555297-64555319 TTGGTGATGTTTACCAAGAAAGG + Intergenic
1054509657 9:65961063-65961085 TTGGTGATGTTTACCAAGAAAGG - Intergenic
1055305697 9:74927091-74927113 TTGGTGAGGATGAGGAAGTAAGG + Intergenic
1055905662 9:81291389-81291411 TTGGTGTACCTGAGGAAGAAGGG - Intergenic
1055941284 9:81652476-81652498 CTGGTGTTGTTTAGAAATAAAGG - Intronic
1056463060 9:86826668-86826690 GTGGTGGTGTTGGGGAAGGAAGG - Intergenic
1057416171 9:94863998-94864020 TTGGGGGTACTGAGGAAGAAGGG + Intronic
1057738289 9:97688100-97688122 TTGATGATGTTGAAAAAGAATGG + Intronic
1057758376 9:97854176-97854198 TTGGGGTTGTCGCGGTAGAAGGG - Exonic
1059248612 9:112868302-112868324 TTGAGGTTGGTGAGGAAGAGTGG + Intronic
1059522055 9:114951986-114952008 TTGGAGTTGAGGAGGAAGAGGGG - Intergenic
1059997030 9:119921076-119921098 TTGGTGAGGATGTGGAAGAAAGG - Intergenic
1061733897 9:132639035-132639057 TTGGTGTTAATGAGGAACGAGGG - Intronic
1185757885 X:2666485-2666507 ATGTTCTTGTTAAGGAAGAATGG + Intergenic
1188112279 X:26206726-26206748 TTGTTGTTGTTGTTGAAGACAGG + Intergenic
1189603287 X:42649634-42649656 TCGGTGTTCCTGAGGAAGAAGGG + Intergenic
1189892665 X:45621620-45621642 TTGGAGTTGGTGGGGAGGAATGG + Intergenic
1190944420 X:55076952-55076974 TTTTTGTTGCTGTGGAAGAATGG + Intronic
1190945664 X:55090885-55090907 TTTTTGTTGCTGTGGAAGAATGG + Intronic
1191820431 X:65300311-65300333 TTGGTGCTGTTGAGGGGGCAGGG + Intergenic
1191914474 X:66186837-66186859 TTGGTATTCCTAAGGAAGAAGGG - Intronic
1192043382 X:67646258-67646280 GTTTTGTTGTTGAGGAAGAGTGG + Intronic
1193446770 X:81615397-81615419 TTGATGTTCCTGAGGAAGAAGGG - Intergenic
1193563643 X:83050657-83050679 TTGGTGCTGTTCTGGAAGTAGGG + Intergenic
1195432311 X:104803082-104803104 CTGCTGTTGGGGAGGAAGAAAGG + Intronic
1195670732 X:107467714-107467736 TTGGTGTGGGTGAGGAAAAATGG - Intergenic
1196086296 X:111685877-111685899 TTGGTGTGTTTGAGGAACAGAGG + Intronic
1196161456 X:112488515-112488537 TTGTTGTTCCTGAGGAAGAAGGG + Intergenic
1196514080 X:116549104-116549126 TTGATGTTGCTGAGGAATGAGGG + Intergenic
1197101281 X:122658525-122658547 TAGGTGTTGTGGAGGAGGTAGGG + Intergenic
1197961911 X:132016346-132016368 TTGGGGTTTTTAAGGAAGAAAGG - Intergenic
1198314016 X:135448985-135449007 TTGTTGTTTTGGAGGAAAAAAGG - Intergenic
1198706913 X:139459563-139459585 TTGCTGTAGTTGTGGAAGAGAGG - Intergenic
1199066122 X:143420624-143420646 TTGGTGAGGATGAGGAAAAAAGG - Intergenic
1199324573 X:146482181-146482203 TTGGTGTCGTTGTGGTAGGAAGG + Intergenic
1199678354 X:150206653-150206675 TTGGTGTTCTTCAAGAAGAGGGG - Intergenic
1200489946 Y:3812585-3812607 TTGGTGTTCCTAAGGGAGAAGGG + Intergenic
1201766643 Y:17579307-17579329 TTGGGATTGTTAAGGTAGAACGG - Intergenic
1201834909 Y:18326677-18326699 TTGGGATTGTTAAGGTAGAACGG + Intergenic