ID: 1053238829

View in Genome Browser
Species Human (GRCh38)
Location 9:36479459-36479481
Sequence ATGTGGGGGTGGAGAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053238820_1053238829 10 Left 1053238820 9:36479426-36479448 CCAGGGTTCTGTTGAGCTTCTGC 0: 1
1: 0
2: 1
3: 19
4: 230
Right 1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG No data
1053238819_1053238829 14 Left 1053238819 9:36479422-36479444 CCAGCCAGGGTTCTGTTGAGCTT 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053238829 Original CRISPR ATGTGGGGGTGGAGAGAAGC AGG Intronic
No off target data available for this crispr