ID: 1053239058

View in Genome Browser
Species Human (GRCh38)
Location 9:36481690-36481712
Sequence ATGCTGTTCTGGGGGCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053239058 Original CRISPR ATGCTGTTCTGGGGGCTCAA GGG (reversed) Intronic
901668148 1:10838147-10838169 ACACTGTTGTGGGTGCTCAATGG + Intergenic
903405323 1:23090859-23090881 ATGCTGTTCTGAGGGCCTACGGG + Intronic
903792107 1:25900846-25900868 ATGTTGTTTTAGGGGCTAAAGGG - Intronic
904746681 1:32715785-32715807 ATTCTGTTCTTGCGGCTCCAAGG - Intergenic
906815449 1:48873921-48873943 GTGTTGTTCTGGGAGCTCAGTGG + Intronic
908445681 1:64197202-64197224 ATGCTGTTCTAAGTGCTCTATGG - Intergenic
910758893 1:90716968-90716990 ATGCGGCTCCGGGGGCTCCATGG + Exonic
911147678 1:94568376-94568398 ATGCTGTTATATGGGCTGAAAGG - Intergenic
912033147 1:105274795-105274817 TTGCTGTTGTGGGGGCACAGTGG - Intergenic
914345278 1:146793792-146793814 CTGCTGTTCTGCAGGATCAAGGG - Intergenic
915910071 1:159909378-159909400 ATGCTGTACTGAGGACTGAATGG - Intergenic
918374464 1:183895292-183895314 ATGCTGTTCTTGGGCTTCAGAGG - Intronic
920212173 1:204336105-204336127 GAGCTGTTTTGGGGGCTCAGTGG - Intronic
924166582 1:241289410-241289432 ATGCTATTCAGGGAGCACAAAGG - Intronic
1062820703 10:532444-532466 ATGCTGTTTTGGTTGCTCTAAGG - Intronic
1064811163 10:19199912-19199934 ACGCTGGTCTGAGGCCTCAAGGG - Intronic
1065207873 10:23374424-23374446 CTGCAGTGCTGTGGGCTCAATGG - Intergenic
1073181032 10:101583324-101583346 AGGCTGTTCTGGGAGCTGAGGGG + Intronic
1076777696 10:132707221-132707243 CTGCTGTTCTTGGTGCTCATGGG - Intronic
1077256321 11:1585021-1585043 TGGCTCTTCTGGGGGCTCCAAGG - Exonic
1077268923 11:1666078-1666100 CCGTTGTTCTGGGGGGTCAAAGG + Intergenic
1078565361 11:12409685-12409707 ATTCCGTTCTGAGGGCTCTAGGG - Intronic
1080592070 11:33733173-33733195 GTGCTGCTCTGGAGGCTCTAGGG - Intronic
1081375401 11:42352317-42352339 ATTCCTTTCTGGGGGCTCTAAGG - Intergenic
1082916527 11:58444181-58444203 TTCCTTTTCTGGGGGCTCCACGG - Intergenic
1083052838 11:59792361-59792383 ATGCTGTGCTGTAGGCTGAAAGG + Intronic
1084297820 11:68224591-68224613 ATGCTGTCCTGGGGGCTTTCTGG + Intergenic
1085275390 11:75295339-75295361 ATTCATTTCTGGAGGCTCAAGGG + Intronic
1085300802 11:75457162-75457184 ATGCTGGACTGGGGGCTCCTTGG - Intronic
1086258418 11:84908099-84908121 TTGCTGTTGTGGAGGCTAAAGGG - Intronic
1087078574 11:94148821-94148843 GGGTTGTTCTGGAGGCTCAAAGG - Intronic
1087609960 11:100422462-100422484 ATGCTGTTGTGGGGTCACAGTGG + Intergenic
1089046836 11:115508430-115508452 GTGCTCTTCTGGGGGCTGGAAGG - Intergenic
1090091733 11:123703985-123704007 CCCCTGTTCTAGGGGCTCAAAGG - Intergenic
1090729213 11:129555279-129555301 CTACTGTTCTGCGGGCTCAGAGG - Intergenic
1092845343 12:12579805-12579827 ATTCTTTTCTGGAGGCTCTAGGG + Intergenic
1093414627 12:18906284-18906306 ATGATGTTCTGGGAGCTCAGAGG + Intergenic
1095672772 12:44879203-44879225 ATTCTTTTCTGGAGGCTCTAAGG - Intronic
1096623741 12:52880265-52880287 GTGCTGTGCTGGGGACCCAAGGG - Intergenic
1098033080 12:66274267-66274289 ATGCTATTTTGGGGTCTGAATGG - Intergenic
1100379658 12:94049733-94049755 ATTCTCATCTGGAGGCTCAATGG + Intergenic
1101229129 12:102721899-102721921 ATACTGTCCTGAGGGCACAAAGG + Intergenic
1101915153 12:108890103-108890125 ATGTTGTTCTGTGGGCCCAAAGG - Intronic
1103564082 12:121806694-121806716 AGGCGGCTCTGGGTGCTCAAGGG + Intronic
1104203296 12:126613232-126613254 ATGCAGTTTTGGGGGAACAATGG + Intergenic
1104882589 12:132082869-132082891 ATGCTGCTCTGGGGGCTGGTCGG - Intergenic
1105853253 13:24354415-24354437 TTGCTGTTCTTGGGGAGCAATGG - Intergenic
1108522503 13:51258922-51258944 ATGCTGTTCCGGGGGCACTGGGG + Intronic
1109197158 13:59390735-59390757 GTGCTGTTGTGGGGGCACAGTGG - Intergenic
1111545728 13:89733225-89733247 ATGGTGTTCTTGGAGCTCACTGG + Intergenic
1113008924 13:105741031-105741053 GTGCTGTCCTGGGGGCCCACAGG - Intergenic
1116637063 14:47410195-47410217 ATGCTTTTCTTGGTGCTAAATGG - Intronic
1116835686 14:49767693-49767715 CTGCTGTTCTGCGGGCGCGAGGG - Exonic
1117871412 14:60204974-60204996 ATGTTATTCTGGAGGCTGAAAGG + Intergenic
1119377604 14:74207100-74207122 ATGGTGGTCGGGGGGCTCATGGG + Intergenic
1119775990 14:77249101-77249123 AGTCAGTTCTCGGGGCTCAAGGG + Intronic
1120050246 14:79857594-79857616 ATAGTGTCCTGGGGGATCAAAGG - Intronic
1120823489 14:88934353-88934375 ATGCTTTTCTTGGAGCTAAAGGG - Intergenic
1121182519 14:91940164-91940186 GTGCTCTTCTGGAGGCTCTAAGG - Intronic
1122254845 14:100469107-100469129 ATGCTGGCCTGAGGGTTCAAGGG - Intronic
1122386343 14:101350895-101350917 GTGCTGTTCTGGGGATTCATGGG - Intergenic
1122577475 14:102751262-102751284 ATGCCGTTCTGGGTGCTGGAAGG - Intergenic
1122655947 14:103259320-103259342 ACGCTGTACTGGGCGCACAAAGG + Intergenic
1122823543 14:104358990-104359012 CTGCTGTTCTGAGGGCTCAGCGG + Intergenic
1124184074 15:27506564-27506586 ATTCTTTTCTGGGGGCTCTAGGG - Intronic
1124376951 15:29134461-29134483 AGGATGTGCTGGGGGCTCACGGG + Intronic
1126873623 15:53014577-53014599 ATGCTGTTCTGGGACCTGGAAGG - Intergenic
1127717062 15:61658916-61658938 ATTCTGGTCTTGGGGGTCAAAGG + Intergenic
1127908146 15:63392487-63392509 ATGCTGTCCTGGGGGATCTAAGG + Intergenic
1128237858 15:66079832-66079854 CTGGTGTTCTGGGGTCTCCATGG + Intronic
1129245645 15:74277289-74277311 ATGCTGGGCTGGGGTCTCTAGGG - Intronic
1129316737 15:74749805-74749827 CTGGTATTCTGGGTGCTCAAGGG + Exonic
1129771666 15:78206836-78206858 ATGCTTTTCTGGGGCTCCAAGGG + Intronic
1130764859 15:86859535-86859557 ATGCTGTCCTTTGGGTTCAAAGG + Intronic
1132617849 16:851284-851306 AGGCTGCTCTGGGGACTCCAGGG + Intergenic
1133018300 16:2955019-2955041 ATGCTGTCCTCGGGCCTCACGGG - Intergenic
1138260150 16:55613758-55613780 ATGAAGTTCTGGAGGCTGAAGGG - Intergenic
1138586742 16:57975663-57975685 ATGCTGTTCTGGAAGCTGTATGG + Intergenic
1139988714 16:70921500-70921522 CTGCTGTTCTGCAGGATCAAGGG + Intronic
1148334552 17:46832636-46832658 AGGCAGGGCTGGGGGCTCAAGGG - Intronic
1149622652 17:58057686-58057708 ATGATGCTCTGGGGGCTTAGAGG + Intergenic
1150896196 17:69213567-69213589 GTGCTGTTGTGGGGGCACAGTGG - Intronic
1151223271 17:72629732-72629754 GTGCTTTTCTGGAGGCTCCAGGG + Intergenic
1151350771 17:73530819-73530841 ATGCTCTACTGGGGCCACAAGGG - Intronic
1151649748 17:75459326-75459348 ATGGTGGTCTGGTGGTTCAAGGG - Intronic
1151817107 17:76476796-76476818 AGGCTCTCCTGGGGGCTCCAGGG + Intronic
1152320286 17:79605063-79605085 ATGGTGTTCGGGCTGCTCAAGGG + Intergenic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1152564808 17:81095599-81095621 ATGCTCATGTGGGGGCTCCAAGG + Intronic
1152813711 17:82394659-82394681 AGGATGTTCTGAGGGCTCAGAGG - Intronic
1153160490 18:2199388-2199410 ATGCTGTTCTGGGAACTGGAGGG - Intergenic
1153257338 18:3184769-3184791 ATGCTTTGCACGGGGCTCAAGGG + Intronic
1153599731 18:6768577-6768599 ATCCTTTTCTGGGGGGTCAGGGG + Intronic
1155573856 18:27224064-27224086 GTGCTGTTGTGGGGGCACAGTGG - Intergenic
1156975751 18:43219951-43219973 CTGAAGTTCTGGGGGCTCAGCGG + Intergenic
1157850423 18:51043708-51043730 ATGCTATGCTGGGGCCTTAACGG - Intronic
1158859490 18:61578577-61578599 ATGCTGTTTAAGGGACTCAATGG + Intergenic
1160291857 18:77601872-77601894 ATGGTGTGCTGGGGACACAAAGG + Intergenic
1162356538 19:10188947-10188969 ATTCCTTTCTGGGGGCTCCAGGG - Intronic
1163420714 19:17212204-17212226 ATCCTCTTCTAGGGGCTCCAGGG - Exonic
1166230948 19:41425628-41425650 ATGCTGGCCTGGGGGCCCAGGGG + Exonic
1166438127 19:42786772-42786794 ATGATGATCTGAGGGCTCAGAGG + Intronic
1166457083 19:42950566-42950588 ATGATGATCTGAGGGCTCAGAGG + Intronic
1166473159 19:43097511-43097533 ATGATGATCTGAGGGCTCAGAGG + Intronic
1166487109 19:43222613-43222635 ATGATGATCTGAGGGCTCAGAGG + Intronic
1166645976 19:44532040-44532062 ATGCAGTTCTGGAGGCTGGAAGG - Intergenic
1166713081 19:44949416-44949438 CTGCTTTTCTGAGGACTCAAGGG + Exonic
925335802 2:3098423-3098445 AGACTTGTCTGGGGGCTCAAGGG - Intergenic
926977394 2:18528965-18528987 ATGCAGTTCTAGGGGCATAAGGG + Intergenic
927124969 2:20005811-20005833 ATGCTCCTCTAGGGGCTCACTGG + Exonic
927387075 2:22547223-22547245 TTTCTATTCTAGGGGCTCAAAGG + Intergenic
928807048 2:35171442-35171464 ATTCTTTTCTGGAGGCTCCAGGG - Intergenic
929285147 2:40127392-40127414 CTGCAGTTCTGGTTGCTCAAGGG - Intronic
929749473 2:44694871-44694893 ATGCTTTTATGGAGGCCCAAAGG + Intronic
931140667 2:59454130-59454152 ATGCTGTTGTCGTGGCGCAAAGG + Intergenic
931596999 2:63958241-63958263 AAGGTGTTCTGGGAGCTCAGAGG + Intronic
933173707 2:79154487-79154509 CTGCTGTGCTGGGGGTCCAAAGG + Intergenic
935082379 2:99810787-99810809 GTTCTGTTCTGGAGGCTCTAGGG + Intronic
938120462 2:128629368-128629390 AAGCTGTTCTGGGGTCCCTATGG - Intergenic
938923391 2:136016100-136016122 ATGCTGTTCTAGGTGGTCAGAGG - Intergenic
940862373 2:158783809-158783831 ATGCTGAACTGGGGACTAAAGGG + Intergenic
941599436 2:167523054-167523076 ATGCTTTTCTGGGGAGTCATGGG - Intergenic
945522225 2:210843191-210843213 ATGGTGTTATGGGGGCTTAGAGG - Intergenic
946317907 2:218930491-218930513 ATGGTTTGCTGGGGGCTCTAGGG - Intergenic
947017657 2:225639117-225639139 AACCTGTTCTGGGGGAGCAAAGG - Intronic
1169497326 20:6127810-6127832 ATGGTTTTCTGGAGGCTGAAAGG + Intergenic
1169917362 20:10696965-10696987 ATGCTGGTCTGGTGTCTCTAAGG - Intergenic
1171173293 20:23034180-23034202 GGGCTGTACTGGGGGCTAAAGGG + Intergenic
1171378668 20:24714988-24715010 ATGCTCTTGTGGGGGCACAGTGG - Intergenic
1172523123 20:35582178-35582200 GTGCTGTTCTGGGGTCTTAGGGG - Intergenic
1173409575 20:42797911-42797933 ATTCTTTTCTGGAGGCTCTAGGG - Intronic
1173819007 20:46008877-46008899 CTGCTGTTGTGGGGGCTTTAAGG - Intergenic
1174290646 20:49506067-49506089 CTCCTGTTCTTTGGGCTCAAGGG - Exonic
1174787902 20:53449843-53449865 ATGGTGCTCTGGAGGCTCATGGG - Intronic
1179337645 21:40473056-40473078 ATGTTGTTCTGGGGGAATAAAGG + Intronic
1180700268 22:17777746-17777768 ATGCAGTTCTGGGGGCGCCATGG - Intergenic
1180990647 22:19933744-19933766 ATGCTGTTCTGTGGGAGGAAGGG + Intronic
1181273223 22:21672981-21673003 GTGGTGTTCTGGGGGCTGCAGGG + Intronic
1181367102 22:22386355-22386377 ATTATGTTCTGCTGGCTCAAAGG - Intergenic
1181495945 22:23287565-23287587 ATGCTGTCCTGGGGCCTTGAGGG + Intronic
1182017211 22:27050921-27050943 GTGGTGTTCTGGGAGCTGAAAGG + Intergenic
1182256553 22:29043148-29043170 TTGCTCTTCTGGGAGCTCCAAGG + Intronic
1182396584 22:30040686-30040708 ATGCTGCCCTTGGGGCTCAGAGG - Intergenic
1182458588 22:30468738-30468760 AGCCTGGTCTGGGGTCTCAAGGG - Intronic
1184204223 22:42990982-42991004 ACGCTGTTGTGAGGACTCAACGG + Intronic
949344491 3:3064244-3064266 ATTCTATCCTGGGGGATCAATGG - Intergenic
950031798 3:9858652-9858674 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
950417125 3:12875152-12875174 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
951489225 3:23250075-23250097 ATGCTGTTCTGGGAGCTTTATGG + Intronic
952082836 3:29781778-29781800 GTGCTGTTGTGGGGGCACAGTGG + Intronic
952183263 3:30941778-30941800 ATGCTGTTGTGGGGGCATAGTGG - Intergenic
953608712 3:44429327-44429349 ATGACCTTCTGGGGGCTGAAGGG - Intergenic
956876409 3:73468294-73468316 ATTCTTTTCTGGAGGCTCTAAGG - Intronic
959122692 3:102251927-102251949 ATGCTGTACTGAGGGTACAAAGG + Intronic
960249340 3:115435062-115435084 ATCCTGCTTTGAGGGCTCAATGG - Intergenic
961606033 3:128096182-128096204 CTGCAGTGCTGGGGGCACAAAGG - Intronic
961783848 3:129337655-129337677 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
963224710 3:142850671-142850693 AAGCTGTTCTGGTGGCACCATGG + Intronic
968698591 4:2044225-2044247 CAGCTGCTCTGGGGGCTCAGGGG - Intergenic
968736002 4:2296898-2296920 GAGCTCTTCTGGGGGCTCAGAGG - Intronic
969524284 4:7696232-7696254 AAGCTGTTCTGGGGCCCCAGAGG - Intronic
971343066 4:25788327-25788349 ATGCTGTTCTGGGGGCAGCAAGG - Exonic
973727239 4:53788894-53788916 ATGCTGTGCTGGGGCCTTGAAGG + Intronic
973889786 4:55357394-55357416 ATGCTGTTCTGCAGGCTCCCAGG - Intronic
974858904 4:67496000-67496022 ATGATGTTCTGGGGCTTAAAAGG + Intronic
978076636 4:104539322-104539344 ATGGAGTTATGGGAGCTCAAGGG - Intergenic
983298977 4:165901767-165901789 GTGCTGTTCTGGGAGATCCATGG + Intronic
983417732 4:167480053-167480075 ATGCTGTTCTGGAAGGTCACGGG + Intergenic
985765017 5:1772925-1772947 AAGCTGTGCTGGGAGCTGAAAGG + Intergenic
986832241 5:11592720-11592742 ATGCTTTTCTGGGGGGGTAAGGG + Intronic
987133054 5:14876625-14876647 ATGCTATTTTGGGGGCAAAAAGG + Intergenic
993525799 5:88964304-88964326 ATGCTGTTTTGAGGGCTGCAAGG + Intergenic
993636809 5:90353946-90353968 ATCTGGATCTGGGGGCTCAATGG - Intergenic
994833932 5:104823857-104823879 ATGGAGTTCTGGGGACTCAGGGG - Intergenic
996197779 5:120631480-120631502 GTGTTGTTATGGGGGCACAATGG + Intronic
1000111902 5:158116148-158116170 ATGCTGTGGTGGGTGCTCTAGGG - Intergenic
1000614101 5:163408851-163408873 TTGCTGTTCTGTGGTCTCACAGG + Intergenic
1001314503 5:170632847-170632869 ATGCTGTGCTGAGGGTTCCATGG + Intronic
1002839349 6:892784-892806 ATGGAGCTCTGGGGGCTCACAGG - Intergenic
1005244087 6:23861954-23861976 GTGCTGTTGTGGGGGCACAGTGG + Intergenic
1007930747 6:45688145-45688167 ATGCAGTTCTGGGGACAGAATGG + Intergenic
1008386605 6:50898179-50898201 CTGCTGTTCTAGGAGCTGAAAGG + Intergenic
1008667439 6:53729927-53729949 AAGCTGTTGTTGGGGCTTAAGGG + Intergenic
1010953631 6:82066364-82066386 ATGCCTTTCTGGAGGCTCTAGGG + Intergenic
1016544428 6:145204622-145204644 ATGCTGTTGTAAGGGCTGAAAGG + Intergenic
1018541331 6:164882985-164883007 TTACAGTTCTGGGGGCTAAAAGG + Intergenic
1019187393 6:170228774-170228796 CTCCTGCTCTGGGGGCTCATTGG - Intergenic
1019599251 7:1873289-1873311 GTCCTGTCCTGGGGCCTCAATGG + Intronic
1026760389 7:73122023-73122045 TTGCTGCTCTAGGGTCTCAAGGG - Intergenic
1027036731 7:74930844-74930866 TTGCTGCTCTAGGGTCTCAAGGG - Intergenic
1027086832 7:75270615-75270637 TTGCTGCTCTAGGGTCTCAAGGG + Intergenic
1028114363 7:86981079-86981101 ATGGTGTTCTGGAAGCTCAGTGG - Intronic
1028148693 7:87346926-87346948 ATTCTTTTCTGGAGGCTCTAGGG + Intronic
1029393133 7:100288613-100288635 TTGCTGCTCTAGGGTCTCAAGGG + Intergenic
1031270536 7:119643876-119643898 ATGCTGTTCTTGATACTCAATGG + Intergenic
1032100755 7:128974924-128974946 CTGCTGTTCTAGGAGCTGAAAGG + Exonic
1036493105 8:9245948-9245970 ATGCTATTCTGGGTGCTATACGG + Intergenic
1037306133 8:17505495-17505517 ATGCTGTTCCCTGGCCTCAAGGG + Intronic
1037735067 8:21559146-21559168 ATGCTGGTCAGGGAGCTCAGGGG + Intergenic
1039475106 8:37835539-37835561 ACGCTGTTCTGGGGGGACATAGG - Exonic
1039769448 8:40668906-40668928 ATGGTGTTCTGGGTAGTCAAGGG - Intronic
1041917204 8:63149638-63149660 ATGCTGTTTTATGGGCTGAAAGG - Intergenic
1042879939 8:73476187-73476209 ATTCTGTTCTGGGTGCTCTGAGG - Intronic
1043615584 8:82120910-82120932 ATGCCTTTCTGGGGGCTGTAGGG + Intergenic
1045799317 8:106083500-106083522 ATACTTTCCTGGGGGCTTAATGG - Intergenic
1048531155 8:135251634-135251656 GTGCTGTTATGGGGGCACAGTGG - Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1049302246 8:141877732-141877754 TTGCTGCTTTGGGGGCTCCAGGG + Intergenic
1050531221 9:6591324-6591346 AAGATGTTCTGGGAGCTCACAGG - Intronic
1053239058 9:36481690-36481712 ATGCTGTTCTGGGGGCTCAAGGG - Intronic
1056091367 9:83208757-83208779 AAGTTGTTCTGGGAGCTTAAAGG + Intergenic
1062448427 9:136605344-136605366 TTCCTGTTCTTGGGGCTCACAGG + Intergenic
1187909698 X:24100042-24100064 ATTCTTTTCTGGGTGCTCTAGGG + Intergenic
1190713254 X:53084261-53084283 ATGCACGTCTGGGGGCTTAAGGG - Intronic
1193079982 X:77397301-77397323 ATTCATTTCTGGAGGCTCAAGGG + Intergenic
1194696275 X:97055133-97055155 ATTCTGTTGTCTGGGCTCAAAGG + Intronic
1195663511 X:107406096-107406118 ATGATGTTCTTGGGGCTGGATGG - Intergenic
1196097083 X:111811869-111811891 TTGCTGTTCTGGGCCATCAAAGG - Intronic
1196324708 X:114389515-114389537 CTGCTGTTCTAGGAGCTGAAAGG - Intergenic
1196871479 X:120116479-120116501 AAGCTGATTTGGGGGCTCAGAGG + Intergenic
1198797311 X:140410787-140410809 GTGCTGTTATGGGGGCACAGTGG - Intergenic
1199711176 X:150470648-150470670 ATGAGGCTCTGGGGGCTGAATGG - Exonic