ID: 1053241913

View in Genome Browser
Species Human (GRCh38)
Location 9:36502776-36502798
Sequence ACATATAGACCATACTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053241910_1053241913 3 Left 1053241910 9:36502750-36502772 CCTGTGTAACCATGATCTGGATC No data
Right 1053241913 9:36502776-36502798 ACATATAGACCATACTGGTCAGG No data
1053241911_1053241913 -6 Left 1053241911 9:36502759-36502781 CCATGATCTGGATCAAAACATAT No data
Right 1053241913 9:36502776-36502798 ACATATAGACCATACTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053241913 Original CRISPR ACATATAGACCATACTGGTC AGG Intergenic
No off target data available for this crispr