ID: 1053244414

View in Genome Browser
Species Human (GRCh38)
Location 9:36522877-36522899
Sequence GTGTATACACACATGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053244411_1053244414 2 Left 1053244411 9:36522852-36522874 CCAATGAGAGTCACCTATACAAT No data
Right 1053244414 9:36522877-36522899 GTGTATACACACATGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053244414 Original CRISPR GTGTATACACACATGGAAAA TGG Intergenic
No off target data available for this crispr