ID: 1053249102 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:36559724-36559746 |
Sequence | TAAGAGGGTATAATTGTCAG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1053249102_1053249106 | 7 | Left | 1053249102 | 9:36559724-36559746 | CCTCTGACAATTATACCCTCTTA | No data | ||
Right | 1053249106 | 9:36559754-36559776 | GCTTTCTGTTCTCTTGGTTAAGG | No data | ||||
1053249102_1053249105 | 1 | Left | 1053249102 | 9:36559724-36559746 | CCTCTGACAATTATACCCTCTTA | No data | ||
Right | 1053249105 | 9:36559748-36559770 | TTATGTGCTTTCTGTTCTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1053249102 | Original CRISPR | TAAGAGGGTATAATTGTCAG AGG (reversed) | Intergenic | ||