ID: 1053249103

View in Genome Browser
Species Human (GRCh38)
Location 9:36559739-36559761
Sequence CAGAAAGCACATAACTAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053249103_1053249106 -8 Left 1053249103 9:36559739-36559761 CCCTCTTAGTTATGTGCTTTCTG No data
Right 1053249106 9:36559754-36559776 GCTTTCTGTTCTCTTGGTTAAGG No data
1053249103_1053249107 17 Left 1053249103 9:36559739-36559761 CCCTCTTAGTTATGTGCTTTCTG No data
Right 1053249107 9:36559779-36559801 TGTTCGCTTGTTTTTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053249103 Original CRISPR CAGAAAGCACATAACTAAGA GGG (reversed) Intergenic