ID: 1053249105

View in Genome Browser
Species Human (GRCh38)
Location 9:36559748-36559770
Sequence TTATGTGCTTTCTGTTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053249102_1053249105 1 Left 1053249102 9:36559724-36559746 CCTCTGACAATTATACCCTCTTA No data
Right 1053249105 9:36559748-36559770 TTATGTGCTTTCTGTTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053249105 Original CRISPR TTATGTGCTTTCTGTTCTCT TGG Intergenic