ID: 1053269421

View in Genome Browser
Species Human (GRCh38)
Location 9:36739956-36739978
Sequence CGTGGCCCCGCAGGTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053269421_1053269431 6 Left 1053269421 9:36739956-36739978 CCCATGGCACCTGCGGGGCCACG No data
Right 1053269431 9:36739985-36740007 GCTCCGGAGCCAGGGTACACAGG No data
1053269421_1053269429 -3 Left 1053269421 9:36739956-36739978 CCCATGGCACCTGCGGGGCCACG No data
Right 1053269429 9:36739976-36739998 ACGCGGGGTGCTCCGGAGCCAGG No data
1053269421_1053269433 11 Left 1053269421 9:36739956-36739978 CCCATGGCACCTGCGGGGCCACG No data
Right 1053269433 9:36739990-36740012 GGAGCCAGGGTACACAGGCCAGG No data
1053269421_1053269430 -2 Left 1053269421 9:36739956-36739978 CCCATGGCACCTGCGGGGCCACG No data
Right 1053269430 9:36739977-36739999 CGCGGGGTGCTCCGGAGCCAGGG No data
1053269421_1053269435 25 Left 1053269421 9:36739956-36739978 CCCATGGCACCTGCGGGGCCACG No data
Right 1053269435 9:36740004-36740026 CAGGCCAGGCCTTCCGTGCCTGG No data
1053269421_1053269427 -10 Left 1053269421 9:36739956-36739978 CCCATGGCACCTGCGGGGCCACG No data
Right 1053269427 9:36739969-36739991 CGGGGCCACGCGGGGTGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053269421 Original CRISPR CGTGGCCCCGCAGGTGCCAT GGG (reversed) Intergenic
No off target data available for this crispr