ID: 1053269427

View in Genome Browser
Species Human (GRCh38)
Location 9:36739969-36739991
Sequence CGGGGCCACGCGGGGTGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053269417_1053269427 -4 Left 1053269417 9:36739950-36739972 CCTCCTCCCATGGCACCTGCGGG No data
Right 1053269427 9:36739969-36739991 CGGGGCCACGCGGGGTGCTCCGG No data
1053269409_1053269427 11 Left 1053269409 9:36739935-36739957 CCTCCTGGCCCCCTTCCTCCTCC No data
Right 1053269427 9:36739969-36739991 CGGGGCCACGCGGGGTGCTCCGG No data
1053269412_1053269427 3 Left 1053269412 9:36739943-36739965 CCCCCTTCCTCCTCCCATGGCAC No data
Right 1053269427 9:36739969-36739991 CGGGGCCACGCGGGGTGCTCCGG No data
1053269407_1053269427 21 Left 1053269407 9:36739925-36739947 CCGGCTGCCTCCTCCTGGCCCCC No data
Right 1053269427 9:36739969-36739991 CGGGGCCACGCGGGGTGCTCCGG No data
1053269421_1053269427 -10 Left 1053269421 9:36739956-36739978 CCCATGGCACCTGCGGGGCCACG No data
Right 1053269427 9:36739969-36739991 CGGGGCCACGCGGGGTGCTCCGG No data
1053269410_1053269427 8 Left 1053269410 9:36739938-36739960 CCTGGCCCCCTTCCTCCTCCCAT No data
Right 1053269427 9:36739969-36739991 CGGGGCCACGCGGGGTGCTCCGG No data
1053269413_1053269427 2 Left 1053269413 9:36739944-36739966 CCCCTTCCTCCTCCCATGGCACC No data
Right 1053269427 9:36739969-36739991 CGGGGCCACGCGGGGTGCTCCGG No data
1053269408_1053269427 14 Left 1053269408 9:36739932-36739954 CCTCCTCCTGGCCCCCTTCCTCC No data
Right 1053269427 9:36739969-36739991 CGGGGCCACGCGGGGTGCTCCGG No data
1053269415_1053269427 0 Left 1053269415 9:36739946-36739968 CCTTCCTCCTCCCATGGCACCTG No data
Right 1053269427 9:36739969-36739991 CGGGGCCACGCGGGGTGCTCCGG No data
1053269420_1053269427 -7 Left 1053269420 9:36739953-36739975 CCTCCCATGGCACCTGCGGGGCC No data
Right 1053269427 9:36739969-36739991 CGGGGCCACGCGGGGTGCTCCGG No data
1053269414_1053269427 1 Left 1053269414 9:36739945-36739967 CCCTTCCTCCTCCCATGGCACCT No data
Right 1053269427 9:36739969-36739991 CGGGGCCACGCGGGGTGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053269427 Original CRISPR CGGGGCCACGCGGGGTGCTC CGG Intergenic
No off target data available for this crispr