ID: 1053269431

View in Genome Browser
Species Human (GRCh38)
Location 9:36739985-36740007
Sequence GCTCCGGAGCCAGGGTACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053269412_1053269431 19 Left 1053269412 9:36739943-36739965 CCCCCTTCCTCCTCCCATGGCAC No data
Right 1053269431 9:36739985-36740007 GCTCCGGAGCCAGGGTACACAGG No data
1053269417_1053269431 12 Left 1053269417 9:36739950-36739972 CCTCCTCCCATGGCACCTGCGGG No data
Right 1053269431 9:36739985-36740007 GCTCCGGAGCCAGGGTACACAGG No data
1053269420_1053269431 9 Left 1053269420 9:36739953-36739975 CCTCCCATGGCACCTGCGGGGCC No data
Right 1053269431 9:36739985-36740007 GCTCCGGAGCCAGGGTACACAGG No data
1053269413_1053269431 18 Left 1053269413 9:36739944-36739966 CCCCTTCCTCCTCCCATGGCACC No data
Right 1053269431 9:36739985-36740007 GCTCCGGAGCCAGGGTACACAGG No data
1053269426_1053269431 -3 Left 1053269426 9:36739965-36739987 CCTGCGGGGCCACGCGGGGTGCT No data
Right 1053269431 9:36739985-36740007 GCTCCGGAGCCAGGGTACACAGG No data
1053269422_1053269431 5 Left 1053269422 9:36739957-36739979 CCATGGCACCTGCGGGGCCACGC No data
Right 1053269431 9:36739985-36740007 GCTCCGGAGCCAGGGTACACAGG No data
1053269408_1053269431 30 Left 1053269408 9:36739932-36739954 CCTCCTCCTGGCCCCCTTCCTCC No data
Right 1053269431 9:36739985-36740007 GCTCCGGAGCCAGGGTACACAGG No data
1053269409_1053269431 27 Left 1053269409 9:36739935-36739957 CCTCCTGGCCCCCTTCCTCCTCC No data
Right 1053269431 9:36739985-36740007 GCTCCGGAGCCAGGGTACACAGG No data
1053269410_1053269431 24 Left 1053269410 9:36739938-36739960 CCTGGCCCCCTTCCTCCTCCCAT No data
Right 1053269431 9:36739985-36740007 GCTCCGGAGCCAGGGTACACAGG No data
1053269421_1053269431 6 Left 1053269421 9:36739956-36739978 CCCATGGCACCTGCGGGGCCACG No data
Right 1053269431 9:36739985-36740007 GCTCCGGAGCCAGGGTACACAGG No data
1053269415_1053269431 16 Left 1053269415 9:36739946-36739968 CCTTCCTCCTCCCATGGCACCTG No data
Right 1053269431 9:36739985-36740007 GCTCCGGAGCCAGGGTACACAGG No data
1053269414_1053269431 17 Left 1053269414 9:36739945-36739967 CCCTTCCTCCTCCCATGGCACCT No data
Right 1053269431 9:36739985-36740007 GCTCCGGAGCCAGGGTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053269431 Original CRISPR GCTCCGGAGCCAGGGTACAC AGG Intergenic
No off target data available for this crispr