ID: 1053269435

View in Genome Browser
Species Human (GRCh38)
Location 9:36740004-36740026
Sequence CAGGCCAGGCCTTCCGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053269422_1053269435 24 Left 1053269422 9:36739957-36739979 CCATGGCACCTGCGGGGCCACGC No data
Right 1053269435 9:36740004-36740026 CAGGCCAGGCCTTCCGTGCCTGG No data
1053269420_1053269435 28 Left 1053269420 9:36739953-36739975 CCTCCCATGGCACCTGCGGGGCC No data
Right 1053269435 9:36740004-36740026 CAGGCCAGGCCTTCCGTGCCTGG No data
1053269432_1053269435 -7 Left 1053269432 9:36739988-36740010 CCGGAGCCAGGGTACACAGGCCA No data
Right 1053269435 9:36740004-36740026 CAGGCCAGGCCTTCCGTGCCTGG No data
1053269426_1053269435 16 Left 1053269426 9:36739965-36739987 CCTGCGGGGCCACGCGGGGTGCT No data
Right 1053269435 9:36740004-36740026 CAGGCCAGGCCTTCCGTGCCTGG No data
1053269421_1053269435 25 Left 1053269421 9:36739956-36739978 CCCATGGCACCTGCGGGGCCACG No data
Right 1053269435 9:36740004-36740026 CAGGCCAGGCCTTCCGTGCCTGG No data
1053269428_1053269435 7 Left 1053269428 9:36739974-36739996 CCACGCGGGGTGCTCCGGAGCCA No data
Right 1053269435 9:36740004-36740026 CAGGCCAGGCCTTCCGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053269435 Original CRISPR CAGGCCAGGCCTTCCGTGCC TGG Intergenic
No off target data available for this crispr