ID: 1053270514

View in Genome Browser
Species Human (GRCh38)
Location 9:36746320-36746342
Sequence ACAACCAAAGGCAGCCCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053270509_1053270514 -8 Left 1053270509 9:36746305-36746327 CCTTGTGTATCCCAGACAACCAA No data
Right 1053270514 9:36746320-36746342 ACAACCAAAGGCAGCCCCGAGGG No data
1053270508_1053270514 21 Left 1053270508 9:36746276-36746298 CCTGGTAACTGCAGTTTCACTTG No data
Right 1053270514 9:36746320-36746342 ACAACCAAAGGCAGCCCCGAGGG No data
1053270506_1053270514 25 Left 1053270506 9:36746272-36746294 CCTCCCTGGTAACTGCAGTTTCA No data
Right 1053270514 9:36746320-36746342 ACAACCAAAGGCAGCCCCGAGGG No data
1053270507_1053270514 22 Left 1053270507 9:36746275-36746297 CCCTGGTAACTGCAGTTTCACTT No data
Right 1053270514 9:36746320-36746342 ACAACCAAAGGCAGCCCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053270514 Original CRISPR ACAACCAAAGGCAGCCCCGA GGG Intergenic