ID: 1053270665

View in Genome Browser
Species Human (GRCh38)
Location 9:36747256-36747278
Sequence GCTTTGGGGTCCAGCTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053270658_1053270665 14 Left 1053270658 9:36747219-36747241 CCAAGTCTATGTTCATGAGTGGA No data
Right 1053270665 9:36747256-36747278 GCTTTGGGGTCCAGCTGACCTGG No data
1053270656_1053270665 25 Left 1053270656 9:36747208-36747230 CCTTCAAGTTGCCAAGTCTATGT No data
Right 1053270665 9:36747256-36747278 GCTTTGGGGTCCAGCTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053270665 Original CRISPR GCTTTGGGGTCCAGCTGACC TGG Intergenic
No off target data available for this crispr