ID: 1053271720

View in Genome Browser
Species Human (GRCh38)
Location 9:36754555-36754577
Sequence CTGGGCAATGAGATGGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053271720_1053271729 10 Left 1053271720 9:36754555-36754577 CCTATCTCCATCTCATTGCCCAG No data
Right 1053271729 9:36754588-36754610 GGACTTATCGCCTTCTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053271720 Original CRISPR CTGGGCAATGAGATGGAGAT AGG (reversed) Intergenic
No off target data available for this crispr