ID: 1053278181

View in Genome Browser
Species Human (GRCh38)
Location 9:36798936-36798958
Sequence GAGGTTTCTGAAGCTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053278181_1053278183 -8 Left 1053278181 9:36798936-36798958 CCAGCAGCAGCTTCAGAAACCTC No data
Right 1053278183 9:36798951-36798973 GAAACCTCCTGGCATTCTCTAGG No data
1053278181_1053278187 10 Left 1053278181 9:36798936-36798958 CCAGCAGCAGCTTCAGAAACCTC No data
Right 1053278187 9:36798969-36798991 CTAGGCATTCTGTAGGCATTTGG No data
1053278181_1053278188 11 Left 1053278181 9:36798936-36798958 CCAGCAGCAGCTTCAGAAACCTC No data
Right 1053278188 9:36798970-36798992 TAGGCATTCTGTAGGCATTTGGG No data
1053278181_1053278190 28 Left 1053278181 9:36798936-36798958 CCAGCAGCAGCTTCAGAAACCTC No data
Right 1053278190 9:36798987-36799009 TTTGGGGAGTTGTTCTGAGCAGG No data
1053278181_1053278186 3 Left 1053278181 9:36798936-36798958 CCAGCAGCAGCTTCAGAAACCTC No data
Right 1053278186 9:36798962-36798984 GCATTCTCTAGGCATTCTGTAGG No data
1053278181_1053278189 12 Left 1053278181 9:36798936-36798958 CCAGCAGCAGCTTCAGAAACCTC No data
Right 1053278189 9:36798971-36798993 AGGCATTCTGTAGGCATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053278181 Original CRISPR GAGGTTTCTGAAGCTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr