ID: 1053278183

View in Genome Browser
Species Human (GRCh38)
Location 9:36798951-36798973
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053278181_1053278183 -8 Left 1053278181 9:36798936-36798958 CCAGCAGCAGCTTCAGAAACCTC No data
Right 1053278183 9:36798951-36798973 GAAACCTCCTGGCATTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053278183 Original CRISPR GAAACCTCCTGGCATTCTCT AGG Intergenic
No off target data available for this crispr