ID: 1053278184

View in Genome Browser
Species Human (GRCh38)
Location 9:36798955-36798977
Sequence AATGCCTAGAGAATGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053278184_1053278189 -7 Left 1053278184 9:36798955-36798977 CCTCCTGGCATTCTCTAGGCATT No data
Right 1053278189 9:36798971-36798993 AGGCATTCTGTAGGCATTTGGGG No data
1053278184_1053278187 -9 Left 1053278184 9:36798955-36798977 CCTCCTGGCATTCTCTAGGCATT No data
Right 1053278187 9:36798969-36798991 CTAGGCATTCTGTAGGCATTTGG No data
1053278184_1053278190 9 Left 1053278184 9:36798955-36798977 CCTCCTGGCATTCTCTAGGCATT No data
Right 1053278190 9:36798987-36799009 TTTGGGGAGTTGTTCTGAGCAGG No data
1053278184_1053278188 -8 Left 1053278184 9:36798955-36798977 CCTCCTGGCATTCTCTAGGCATT No data
Right 1053278188 9:36798970-36798992 TAGGCATTCTGTAGGCATTTGGG No data
1053278184_1053278191 14 Left 1053278184 9:36798955-36798977 CCTCCTGGCATTCTCTAGGCATT No data
Right 1053278191 9:36798992-36799014 GGAGTTGTTCTGAGCAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053278184 Original CRISPR AATGCCTAGAGAATGCCAGG AGG (reversed) Intergenic
No off target data available for this crispr