ID: 1053278185

View in Genome Browser
Species Human (GRCh38)
Location 9:36798958-36798980
Sequence CAGAATGCCTAGAGAATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053278185_1053278190 6 Left 1053278185 9:36798958-36798980 CCTGGCATTCTCTAGGCATTCTG No data
Right 1053278190 9:36798987-36799009 TTTGGGGAGTTGTTCTGAGCAGG No data
1053278185_1053278189 -10 Left 1053278185 9:36798958-36798980 CCTGGCATTCTCTAGGCATTCTG No data
Right 1053278189 9:36798971-36798993 AGGCATTCTGTAGGCATTTGGGG No data
1053278185_1053278191 11 Left 1053278185 9:36798958-36798980 CCTGGCATTCTCTAGGCATTCTG No data
Right 1053278191 9:36798992-36799014 GGAGTTGTTCTGAGCAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053278185 Original CRISPR CAGAATGCCTAGAGAATGCC AGG (reversed) Intergenic
No off target data available for this crispr