ID: 1053278187

View in Genome Browser
Species Human (GRCh38)
Location 9:36798969-36798991
Sequence CTAGGCATTCTGTAGGCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053278184_1053278187 -9 Left 1053278184 9:36798955-36798977 CCTCCTGGCATTCTCTAGGCATT No data
Right 1053278187 9:36798969-36798991 CTAGGCATTCTGTAGGCATTTGG No data
1053278181_1053278187 10 Left 1053278181 9:36798936-36798958 CCAGCAGCAGCTTCAGAAACCTC No data
Right 1053278187 9:36798969-36798991 CTAGGCATTCTGTAGGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053278187 Original CRISPR CTAGGCATTCTGTAGGCATT TGG Intergenic
No off target data available for this crispr