ID: 1053278189

View in Genome Browser
Species Human (GRCh38)
Location 9:36798971-36798993
Sequence AGGCATTCTGTAGGCATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053278181_1053278189 12 Left 1053278181 9:36798936-36798958 CCAGCAGCAGCTTCAGAAACCTC No data
Right 1053278189 9:36798971-36798993 AGGCATTCTGTAGGCATTTGGGG No data
1053278184_1053278189 -7 Left 1053278184 9:36798955-36798977 CCTCCTGGCATTCTCTAGGCATT No data
Right 1053278189 9:36798971-36798993 AGGCATTCTGTAGGCATTTGGGG No data
1053278185_1053278189 -10 Left 1053278185 9:36798958-36798980 CCTGGCATTCTCTAGGCATTCTG No data
Right 1053278189 9:36798971-36798993 AGGCATTCTGTAGGCATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053278189 Original CRISPR AGGCATTCTGTAGGCATTTG GGG Intergenic
No off target data available for this crispr