ID: 1053279155

View in Genome Browser
Species Human (GRCh38)
Location 9:36806128-36806150
Sequence CCCGGCCCTGTGGCCTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053279155_1053279162 11 Left 1053279155 9:36806128-36806150 CCACAGGAGGCCACAGGGCCGGG No data
Right 1053279162 9:36806162-36806184 AGCACTGCCCCTGACTCAGCAGG No data
1053279155_1053279166 20 Left 1053279155 9:36806128-36806150 CCACAGGAGGCCACAGGGCCGGG No data
Right 1053279166 9:36806171-36806193 CCTGACTCAGCAGGTAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053279155 Original CRISPR CCCGGCCCTGTGGCCTCCTG TGG (reversed) Intergenic
No off target data available for this crispr