ID: 1053279408

View in Genome Browser
Species Human (GRCh38)
Location 9:36808140-36808162
Sequence CGCTGGAGGTTTTAAAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053279408_1053279412 3 Left 1053279408 9:36808140-36808162 CCTGGACTTTAAAACCTCCAGCG No data
Right 1053279412 9:36808166-36808188 CTGCCCCATTAAGAGATAAATGG No data
1053279408_1053279416 24 Left 1053279408 9:36808140-36808162 CCTGGACTTTAAAACCTCCAGCG No data
Right 1053279416 9:36808187-36808209 GGACACCAAATCTCTCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053279408 Original CRISPR CGCTGGAGGTTTTAAAGTCC AGG (reversed) Intergenic
No off target data available for this crispr