ID: 1053279953

View in Genome Browser
Species Human (GRCh38)
Location 9:36813836-36813858
Sequence CTAATTTTGACTGGTGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053279950_1053279953 -8 Left 1053279950 9:36813821-36813843 CCAGCAGTGATTCCACTAATTTT No data
Right 1053279953 9:36813836-36813858 CTAATTTTGACTGGTGTTTCAGG No data
1053279949_1053279953 13 Left 1053279949 9:36813800-36813822 CCTATTCAGTCATTGACTCTACC No data
Right 1053279953 9:36813836-36813858 CTAATTTTGACTGGTGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053279953 Original CRISPR CTAATTTTGACTGGTGTTTC AGG Intergenic
No off target data available for this crispr