ID: 1053282188

View in Genome Browser
Species Human (GRCh38)
Location 9:36827662-36827684
Sequence GATCAGAGTAGACCAAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053282184_1053282188 11 Left 1053282184 9:36827628-36827650 CCCAAATAGTCCTATGTTTAGAA No data
Right 1053282188 9:36827662-36827684 GATCAGAGTAGACCAAGAGCAGG No data
1053282185_1053282188 10 Left 1053282185 9:36827629-36827651 CCAAATAGTCCTATGTTTAGAAG No data
Right 1053282188 9:36827662-36827684 GATCAGAGTAGACCAAGAGCAGG No data
1053282187_1053282188 1 Left 1053282187 9:36827638-36827660 CCTATGTTTAGAAGCAAGGCAGA No data
Right 1053282188 9:36827662-36827684 GATCAGAGTAGACCAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053282188 Original CRISPR GATCAGAGTAGACCAAGAGC AGG Intergenic
No off target data available for this crispr