ID: 1053283785

View in Genome Browser
Species Human (GRCh38)
Location 9:36837955-36837977
Sequence GTACACATCATTCCAAAAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 177}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053283781_1053283785 7 Left 1053283781 9:36837925-36837947 CCACAAGGAGGGCAGGATCCAAA 0: 1
1: 0
2: 1
3: 14
4: 175
Right 1053283785 9:36837955-36837977 GTACACATCATTCCAAAAGAAGG 0: 1
1: 0
2: 1
3: 5
4: 177
1053283779_1053283785 14 Left 1053283779 9:36837918-36837940 CCTGGAACCACAAGGAGGGCAGG 0: 1
1: 0
2: 2
3: 36
4: 309
Right 1053283785 9:36837955-36837977 GTACACATCATTCCAAAAGAAGG 0: 1
1: 0
2: 1
3: 5
4: 177
1053283772_1053283785 28 Left 1053283772 9:36837904-36837926 CCTCCTCCCAACAGCCTGGAACC 0: 1
1: 0
2: 3
3: 26
4: 309
Right 1053283785 9:36837955-36837977 GTACACATCATTCCAAAAGAAGG 0: 1
1: 0
2: 1
3: 5
4: 177
1053283774_1053283785 22 Left 1053283774 9:36837910-36837932 CCCAACAGCCTGGAACCACAAGG 0: 1
1: 0
2: 1
3: 13
4: 181
Right 1053283785 9:36837955-36837977 GTACACATCATTCCAAAAGAAGG 0: 1
1: 0
2: 1
3: 5
4: 177
1053283776_1053283785 21 Left 1053283776 9:36837911-36837933 CCAACAGCCTGGAACCACAAGGA 0: 1
1: 0
2: 1
3: 19
4: 234
Right 1053283785 9:36837955-36837977 GTACACATCATTCCAAAAGAAGG 0: 1
1: 0
2: 1
3: 5
4: 177
1053283773_1053283785 25 Left 1053283773 9:36837907-36837929 CCTCCCAACAGCCTGGAACCACA 0: 1
1: 0
2: 2
3: 98
4: 1437
Right 1053283785 9:36837955-36837977 GTACACATCATTCCAAAAGAAGG 0: 1
1: 0
2: 1
3: 5
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053283785 Original CRISPR GTACACATCATTCCAAAAGA AGG Exonic
901183298 1:7356449-7356471 GGACACATCTTTCAAAAAGCAGG - Intronic
903354514 1:22738153-22738175 GTATAAATCATCCCCAAAGAGGG - Intronic
903882285 1:26519328-26519350 GTACATTTCATTCAAACAGATGG + Intergenic
906469285 1:46114232-46114254 AGCCACATCATTCCAAATGAAGG + Intronic
909158175 1:72108179-72108201 GTACTCATAAATCCATAAGATGG + Intronic
909953031 1:81742560-81742582 CTTCACATGATGCCAAAAGAAGG - Intronic
910840236 1:91554382-91554404 GTTTACATAATTCAAAAAGAAGG + Intergenic
911676218 1:100661230-100661252 TTTCCCATCATTCCAAGAGATGG + Intergenic
912871011 1:113306338-113306360 TGACACATCATTTCAATAGAAGG - Intergenic
915707299 1:157857265-157857287 GTTCACTTCTTTCCAAAAGTTGG + Intronic
919020400 1:192098076-192098098 GTAAAAATCACTCCAAAATATGG + Intergenic
922175583 1:223194761-223194783 TTACAAATCATCCCAAAACACGG - Intergenic
1063032071 10:2245325-2245347 GTCCACATCATTCCTAGACATGG - Intergenic
1064025099 10:11842361-11842383 AAAAAAATCATTCCAAAAGAAGG - Intronic
1064063888 10:12163924-12163946 CTACTCTTCATTCCACAAGAGGG + Intronic
1065843063 10:29721262-29721284 AAACACCTCAATCCAAAAGAAGG + Intronic
1067010679 10:42710364-42710386 ATACACATTATTACAAAATAAGG + Intergenic
1067271292 10:44793524-44793546 GTACACATTTTCCCAAAAGCAGG + Intergenic
1067312828 10:45130835-45130857 ATACACATTATTACAAAATAGGG - Intergenic
1068682007 10:59830312-59830334 ATACAGATAATTCCAAGAGATGG + Intronic
1070035464 10:72718426-72718448 ATCCACATCATTCCCAAAGGAGG - Intronic
1070047921 10:72857733-72857755 GTGAAAATTATTCCAAAAGAGGG + Intronic
1074466370 10:113685268-113685290 GTACACAACATTCTCCAAGATGG - Intronic
1077455807 11:2679541-2679563 GTACACATGATTACAATGGATGG - Intronic
1079884993 11:25976442-25976464 GTTCAACTCATTCCTAAAGATGG + Intergenic
1080169221 11:29279054-29279076 GTACAAATCAATCCTAAAGGAGG - Intergenic
1080831736 11:35900353-35900375 CAACACATAATTCCAAAAAAGGG + Intergenic
1081307766 11:41534514-41534536 TTTCACATTATTCCAAATGATGG - Intergenic
1085894770 11:80625672-80625694 CTAAACATCATCCCAAAGGAAGG + Intergenic
1088902081 11:114125971-114125993 GGACACATCACTCCAAGAGTTGG - Intronic
1091674768 12:2481149-2481171 GAACACTTCATCCCAAAAGTAGG + Intronic
1093002136 12:14009161-14009183 GGATAAATCATTCAAAAAGATGG + Intergenic
1094006197 12:25754576-25754598 GTACAAAACATTCTAAAATAGGG - Intergenic
1097252273 12:57642314-57642336 GTACACATCCTAACAAAAAAGGG - Intergenic
1097806824 12:63974370-63974392 GTTAACATCATTACAAATGAAGG + Intronic
1099592046 12:84605677-84605699 CTTCATTTCATTCCAAAAGAGGG + Intergenic
1099613131 12:84901336-84901358 GGACAAATCCTTCAAAAAGATGG - Intronic
1101325934 12:103716043-103716065 TTTCACCTCATTCCCAAAGAAGG - Intronic
1101344846 12:103877609-103877631 GTGAACATCCTTCCAAAAGCAGG - Intergenic
1103806370 12:123576803-123576825 TTAAACATCATGCCAAGAGAAGG + Intergenic
1105982985 13:25537771-25537793 TTAAACATCATTGCAAAAAAAGG + Intronic
1106779115 13:33039083-33039105 GTACATATGATTCCAAAATTAGG + Intronic
1107214767 13:37903412-37903434 TTACACATCTTTACACAAGACGG - Intergenic
1107503199 13:41002123-41002145 GTACAGATAAATCCAAAAGGAGG + Intronic
1110528338 13:76566453-76566475 GTAATCATCCTTCAAAAAGAAGG + Intergenic
1116988913 14:51252346-51252368 TTCCAAATCATTCAAAAAGAAGG + Intronic
1120608726 14:86612203-86612225 GGACACATCATTTTAAAAAATGG + Intergenic
1121579737 14:95019682-95019704 GTAATCTTCATTCCAAAAGTTGG + Intergenic
1122446918 14:101776297-101776319 GTAACCAGCATTCCAGAAGAGGG + Intronic
1126561791 15:50052199-50052221 GTACAGTTCATTCCATAATAAGG + Intronic
1126872344 15:53003009-53003031 GTACACATTATACCCAGAGAAGG - Intergenic
1126945663 15:53816768-53816790 GTACACAGTTTTCCAAAACATGG + Intergenic
1129258211 15:74346474-74346496 GTACACACCAGTCAAAATGAAGG - Intronic
1129767443 15:78179230-78179252 GCACACCCCACTCCAAAAGAGGG + Intronic
1129906900 15:79194757-79194779 GCACACATCATATCAATAGATGG - Intergenic
1132627888 16:900877-900899 GAACTCATAATTCCAAAAGCTGG - Intronic
1133248795 16:4466540-4466562 GTGAACATCATTCCAGGAGAGGG - Intronic
1137806383 16:51310166-51310188 GTAAGCATCATTAGAAAAGAAGG - Intergenic
1139054968 16:63172117-63172139 ATATACATCATTGAAAAAGATGG + Intergenic
1139271292 16:65685710-65685732 GTGGACATTATTCCAAAAGGTGG + Intergenic
1139493902 16:67302232-67302254 GAGCAGGTCATTCCAAAAGAGGG + Intronic
1141351653 16:83303768-83303790 GAACACAACACTCCAAAATATGG - Intronic
1142923616 17:3213100-3213122 GTACACATGATAACAAAAAAAGG + Intergenic
1146535056 17:33642760-33642782 GTTCACATTATACCAAAATAAGG - Intronic
1149509494 17:57227632-57227654 GAACAAATCAATCCAAAAGAGGG - Intergenic
1153469230 18:5425094-5425116 GTACACATCAGACCACCAGAGGG + Intronic
1155796992 18:30051692-30051714 ATACACATAATAACAAAAGATGG + Intergenic
1155822834 18:30399605-30399627 TTACACATCTTTTTAAAAGAGGG + Intergenic
1156638085 18:39055369-39055391 CTACATATTATTCCAAATGAAGG - Intergenic
1157131123 18:45008308-45008330 CTACACATCATTTCAAAACTCGG - Intronic
1159341032 18:67133795-67133817 GTACACATCGTCTCAAAATACGG - Intergenic
1159777398 18:72619451-72619473 GTACAAAGCATTCCAACAAAGGG + Intronic
1161642563 19:5433443-5433465 TTATACATCATTAAAAAAGAGGG + Intergenic
1164845113 19:31425632-31425654 GATTACATCTTTCCAAAAGAGGG + Intergenic
925083557 2:1090321-1090343 GTACACATCATTGCAAAGTTAGG - Intronic
926960373 2:18351687-18351709 ATAGACATTATTCCAGAAGAAGG + Intronic
927603956 2:24469653-24469675 GGACCCTTCATTCCAAAAAAAGG - Intergenic
928292778 2:30054449-30054471 TTACACATCAATCAAAATGATGG + Intergenic
931250420 2:60526206-60526228 GAACACATCATCCCAAAATATGG - Intronic
933541953 2:83655752-83655774 ATGCACATCAATACAAAAGAAGG + Intergenic
934011173 2:87822281-87822303 GTAAACATCATTAAAAAAAAGGG + Intronic
935591567 2:104850586-104850608 CTACACTTCATTCCCAAAGGAGG - Intergenic
935774737 2:106462997-106463019 GTAAACATCATTAAAAAAAAGGG + Intronic
935905330 2:107832915-107832937 GTAAACATCATTAAAAAAAAGGG - Intronic
935936302 2:108187265-108187287 ATACACAGCAATCCAGAAGATGG + Intergenic
936127119 2:109798095-109798117 GTAAACATCATTAAAAAAAAGGG - Intronic
936217578 2:110573391-110573413 GTAAACATCATTAAAAAAAAGGG + Intronic
936426720 2:112427964-112427986 GTAAACATCATTAAAAAAAAGGG + Intronic
936634508 2:114240210-114240232 ATACTCATCACTTCAAAAGAAGG + Intergenic
939361233 2:141175463-141175485 GTTCACATCATTGCATCAGAGGG + Intronic
940097412 2:149993331-149993353 GGACACACTATTCCAAAATATGG - Intergenic
940350076 2:152674737-152674759 GTACCCATCATGTCAAATGATGG - Intronic
942658006 2:178234767-178234789 CTACAAATGATTCCAAAAGCAGG - Intronic
947144269 2:227050478-227050500 ATCCATTTCATTCCAAAAGATGG + Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
1175330429 20:58160047-58160069 GAACAGATTATTTCAAAAGAAGG + Intronic
1177850449 21:26340774-26340796 GTACACATGAACACAAAAGAAGG - Intergenic
1184566529 22:45295352-45295374 GTTCACATCATTCCAAAAGGTGG + Intronic
1184825224 22:46946091-46946113 GTACACAGCTTTCCAAAGGGAGG + Intronic
951947157 3:28151659-28151681 TTATACATCTGTCCAAAAGATGG - Intergenic
955387142 3:58488959-58488981 ATGCAGGTCATTCCAAAAGAGGG + Intergenic
959564783 3:107823386-107823408 GTACACACTACTCCAAAATATGG + Intergenic
964276718 3:155016449-155016471 GTGAAAATGATTCCAAAAGATGG + Intergenic
964305555 3:155335820-155335842 GGACAAATCATTCCAATAGGAGG + Intergenic
966072655 3:175897929-175897951 GAACACATTATTTAAAAAGAAGG + Intergenic
967929374 3:194679656-194679678 GTCCACTTCCTTCCTAAAGAGGG + Intergenic
968076543 3:195818670-195818692 GTAAACTTCATTTTAAAAGATGG - Intergenic
970398128 4:15691432-15691454 GTACTCCTCATCCAAAAAGATGG - Intronic
971329272 4:25669319-25669341 GTCCCCACCTTTCCAAAAGAAGG + Intronic
971506234 4:27369250-27369272 GGACACTTCATCACAAAAGATGG + Intergenic
972020670 4:34309734-34309756 ATACACAGCATTCCAAAGAATGG - Intergenic
973874522 4:55203537-55203559 GATCACATGATTCCAAAAGATGG + Intergenic
974511652 4:62850774-62850796 GTAAAAATCATTCTAAAAGGAGG + Intergenic
975170798 4:71229900-71229922 GAACACATGTTGCCAAAAGATGG + Intronic
975179279 4:71325213-71325235 GTACACATCTCTCCAAAACTTGG + Intronic
979374906 4:119934796-119934818 GTTCACATCAGTCAAAAAGGTGG + Intergenic
979383746 4:120039614-120039636 GTTCACATCAATCAAAAAGGTGG - Intergenic
981745959 4:148052666-148052688 GACCACATCCTTCCACAAGAAGG - Intronic
985352651 4:189082747-189082769 GTACACCCCTTTCCAAAACAGGG - Intergenic
985823198 5:2174863-2174885 CCACACATGATTCCAAAAGCGGG - Intergenic
986865977 5:11987702-11987724 ATACACTTCTTTCCAGAAGAAGG + Intergenic
987111410 5:14690788-14690810 GTACCCCTCATTCAAAAAGGTGG - Intronic
988588139 5:32525616-32525638 GTTCACTTCATTCCGAACGATGG - Intergenic
989367108 5:40669160-40669182 GTACACATCTATGCTAAAGATGG + Intergenic
990558832 5:56963712-56963734 TTACACACCATTCCCTAAGAGGG - Intronic
995462082 5:112414250-112414272 CAACTCACCATTCCAAAAGAGGG + Intronic
995976390 5:118040789-118040811 GTACAGAACATTTCAGAAGATGG - Intergenic
997359151 5:133283376-133283398 GGACACATCTTTCCAAGACAGGG - Intronic
998481531 5:142467060-142467082 AAACAAATCATTCCAACAGATGG - Intergenic
999851578 5:155546072-155546094 TTACACATCATGAGAAAAGAGGG - Intergenic
1000898504 5:166885482-166885504 GTCCACATCTTTTAAAAAGATGG - Intergenic
1002630994 5:180578300-180578322 GTCAACCTCCTTCCAAAAGACGG - Exonic
1004559148 6:16730610-16730632 GTACACATGGTTCCTAAGGAAGG - Intronic
1006199563 6:32275656-32275678 ATAAAAATCATTCCAAAAGGAGG - Intergenic
1006764933 6:36496638-36496660 GTAAACATCATCCCAAAATTGGG + Intronic
1007181324 6:39931413-39931435 GTATACATCATCCCAATAGCAGG - Intronic
1007985130 6:46199765-46199787 GTGGACAGCATCCCAAAAGACGG - Intergenic
1008661570 6:53673218-53673240 GTATACATCATTACAGAAGAAGG - Intergenic
1008685360 6:53920391-53920413 TTATACATCATTAAAAAAGAAGG + Intronic
1010184280 6:73124922-73124944 ATATATATCACTCCAAAAGAAGG - Intronic
1010225465 6:73484732-73484754 GTTCACATTATTTCAAAAGTTGG + Intronic
1011797431 6:90972184-90972206 GTACACTTCCTTCGAAAAGGAGG + Intergenic
1012230399 6:96754297-96754319 GCTCACATCTTTCCAAAACATGG + Intergenic
1012379349 6:98601544-98601566 GCACACATCCTTACAAGAGATGG - Intergenic
1012619662 6:101326778-101326800 AGAAACATCATTCCATAAGAAGG - Intergenic
1013667685 6:112365591-112365613 TTTCTCATCATTCCAAGAGATGG - Intergenic
1015861434 6:137684674-137684696 GATCACATCACTCCAAGAGATGG - Intergenic
1017280742 6:152621925-152621947 ATACACATTCTTCAAAAAGAGGG + Intronic
1018217309 6:161541486-161541508 TAACACATTATTCAAAAAGATGG + Intronic
1018594587 6:165464720-165464742 TTACAAATAATTCCAAAAGCTGG - Intronic
1020587554 7:10088135-10088157 GGACACACTGTTCCAAAAGATGG + Intergenic
1026117852 7:67511308-67511330 TTAAACTTCATTCCAAATGATGG + Intergenic
1027641609 7:80740507-80740529 GTTCACATCAGCTCAAAAGAAGG + Intergenic
1028165278 7:87531364-87531386 GTACCCATCATTGCAATAGCAGG - Exonic
1030049725 7:105527207-105527229 GTAAACATAAATCCAAAAAAAGG - Intergenic
1033449709 7:141451451-141451473 GGCCACATCATTCCCAAAGCTGG + Intronic
1033561285 7:142534706-142534728 CTACACATCAATCATAAAGAAGG + Intergenic
1035014271 7:155751076-155751098 ATACATATCATTCCAAAAGTGGG - Intronic
1037068181 8:14609627-14609649 TGACACATCATTCTAAAAGCTGG + Intronic
1037409759 8:18583868-18583890 GTATACAACATTCTAGAAGACGG + Intronic
1041336324 8:56788555-56788577 ATAAACATCATTCCAAGAAAAGG - Intergenic
1044644766 8:94427839-94427861 GTTGACATTACTCCAAAAGAAGG + Intronic
1045635650 8:104185484-104185506 GTAAACATTATACTAAAAGAGGG + Intronic
1048082764 8:131147230-131147252 GTTGACATCAGTCCAAAAGTGGG - Intergenic
1048957977 8:139552524-139552546 ACACACATCCTTCCAAAAGCTGG - Intergenic
1050425491 9:5508808-5508830 GTGCACCTCACTCCTAAAGAAGG + Intergenic
1052962504 9:34312178-34312200 TTTCAGATCATTCCAAAAGGTGG + Intronic
1053283785 9:36837955-36837977 GTACACATCATTCCAAAAGAAGG + Exonic
1055051610 9:71987247-71987269 GAGCACAGCATTTCAAAAGACGG - Intergenic
1055122787 9:72682042-72682064 GGACTCACCAATCCAAAAGAGGG - Intronic
1058018290 9:100061885-100061907 GAACACATTACTCCAAAATATGG + Intronic
1058248526 9:102661127-102661149 GTAAACCTCTTTTCAAAAGAAGG - Intergenic
1059793842 9:117669228-117669250 TTTCACATGGTTCCAAAAGACGG - Intergenic
1061224596 9:129273425-129273447 GTAAACATCATACAAAATGATGG - Intergenic
1186499381 X:10039047-10039069 GTACCCTTAATTCCAAAGGATGG + Intronic
1186566495 X:10668483-10668505 GTTCACATAATTTAAAAAGACGG + Intronic
1189960818 X:46323387-46323409 GGACACACTACTCCAAAAGATGG - Intergenic
1190428217 X:50352493-50352515 GTACACATCACCCCAAAGGTAGG - Intergenic
1194882290 X:99268882-99268904 GTTGACATTATTCCACAAGATGG - Intergenic
1194916572 X:99716328-99716350 GCACACATCAAGCAAAAAGATGG + Intergenic
1195382881 X:104287484-104287506 GTACATCTAATTTCAAAAGATGG - Intergenic
1195968586 X:110451131-110451153 GTACACACCACTCCAGAGGATGG - Exonic
1196789718 X:119452871-119452893 CTAAACATAATTCCAAAATATGG - Exonic
1197640751 X:128965578-128965600 GTTCAAATCAGTCCAAAAGTTGG - Intergenic