ID: 1053283927

View in Genome Browser
Species Human (GRCh38)
Location 9:36838577-36838599
Sequence CAGTTTCCCACAAGGGAAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 219}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053283922_1053283927 -9 Left 1053283922 9:36838563-36838585 CCCAAGCTGGGCCTCAGTTTCCC 0: 2
1: 2
2: 60
3: 363
4: 1157
Right 1053283927 9:36838577-36838599 CAGTTTCCCACAAGGGAAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 219
1053283915_1053283927 12 Left 1053283915 9:36838542-36838564 CCCTGCATGGTCCTGGCCTTCCC 0: 1
1: 0
2: 2
3: 33
4: 334
Right 1053283927 9:36838577-36838599 CAGTTTCCCACAAGGGAAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 219
1053283920_1053283927 -4 Left 1053283920 9:36838558-36838580 CCTTCCCCAAGCTGGGCCTCAGT 0: 1
1: 2
2: 14
3: 90
4: 586
Right 1053283927 9:36838577-36838599 CAGTTTCCCACAAGGGAAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 219
1053283921_1053283927 -8 Left 1053283921 9:36838562-36838584 CCCCAAGCTGGGCCTCAGTTTCC 0: 1
1: 1
2: 28
3: 281
4: 1017
Right 1053283927 9:36838577-36838599 CAGTTTCCCACAAGGGAAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 219
1053283919_1053283927 1 Left 1053283919 9:36838553-36838575 CCTGGCCTTCCCCAAGCTGGGCC 0: 1
1: 0
2: 3
3: 43
4: 392
Right 1053283927 9:36838577-36838599 CAGTTTCCCACAAGGGAAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 219
1053283923_1053283927 -10 Left 1053283923 9:36838564-36838586 CCAAGCTGGGCCTCAGTTTCCCA 0: 2
1: 7
2: 47
3: 524
4: 2183
Right 1053283927 9:36838577-36838599 CAGTTTCCCACAAGGGAAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 219
1053283916_1053283927 11 Left 1053283916 9:36838543-36838565 CCTGCATGGTCCTGGCCTTCCCC 0: 1
1: 0
2: 3
3: 49
4: 336
Right 1053283927 9:36838577-36838599 CAGTTTCCCACAAGGGAAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053283927 Original CRISPR CAGTTTCCCACAAGGGAAGT TGG Exonic
900343451 1:2199436-2199458 CAATTTCCCAGCAGGGCAGTGGG - Intronic
901080504 1:6581166-6581188 CAGTTTCCCACAGAGGGAGGAGG - Exonic
903919121 1:26787291-26787313 CAGTTTCTCTCATAGGAAGTGGG - Intergenic
904884436 1:33725726-33725748 CAGTTTCCAACCATGGAAGGAGG - Intronic
905783681 1:40735040-40735062 CAGTTTCCCAGAACTGGAGTGGG + Intronic
906892593 1:49733605-49733627 CAGTTTCCAACATGTGAATTTGG - Intronic
908282786 1:62559896-62559918 CAGATTCCCAGAAGGAAAGTAGG - Intronic
910493279 1:87796652-87796674 CAGCTTGCCAGAAGAGAAGTAGG + Intergenic
911321737 1:96421803-96421825 CAGTGCCCCACGAGGGAAGGAGG - Intergenic
912379090 1:109237212-109237234 CAGGGTCCCAGAGGGGAAGTCGG - Intronic
914433131 1:147637693-147637715 CAGTTGCCCACAACTGAAGAGGG - Intronic
916984689 1:170178192-170178214 CAATTTCAGGCAAGGGAAGTAGG + Intergenic
919732065 1:200919676-200919698 CTGTTTGCCCCAAGTGAAGTCGG - Intergenic
920130935 1:203731333-203731355 CATTTTCCCAGGAGGGAAGATGG - Intronic
920343919 1:205293756-205293778 CAGTTTCACACAAGGGTATTCGG - Intergenic
921340060 1:214125597-214125619 CATGTTCCCTCAAGGGAAGACGG + Intergenic
921474450 1:215589576-215589598 CAGATTCCCAGAAGGAAAGAAGG + Intronic
921720574 1:218466208-218466230 CAGTTTCCCAGCTGGGAAGATGG + Intergenic
921770812 1:219037720-219037742 CTGTTTCCCACAATGGAAGCAGG - Intergenic
922029143 1:221781291-221781313 CAGTTTCCCCAAAGTGAACTGGG - Intergenic
922595660 1:226810873-226810895 CAGATGCCCAGAAGGCAAGTGGG - Intergenic
922709611 1:227816665-227816687 CAGATTCCCACAAGTGAGGCTGG + Intronic
922709619 1:227816704-227816726 CAGATTCCCACAAGTGAGGCTGG + Intronic
924052103 1:240089511-240089533 CATTTTCCCACAAAGGAAATTGG - Intronic
1065687408 10:28300365-28300387 CAGTGTCCCACAATGCAAGAGGG + Intronic
1067297429 10:44982743-44982765 CAGTGTCCCATAAGGGAACAGGG - Intronic
1072000396 10:91189739-91189761 CTGTTTCCCACCAGGCAAGAAGG - Intronic
1073181246 10:101584813-101584835 CAATCTCCCTCAAGGGAGGTGGG + Exonic
1074242771 10:111655336-111655358 CAGTTTCATTCTAGGGAAGTTGG + Intergenic
1075564814 10:123495479-123495501 CAGTTGCCCACAGAGGAAGTTGG - Intergenic
1078112508 11:8408984-8409006 CAGACTCCCAGAAGGAAAGTAGG + Intronic
1078123168 11:8531202-8531224 CAGTTTCCTTTAAGCGAAGTTGG - Intronic
1078443603 11:11387413-11387435 CAGTTGCCCAGGAGGGGAGTGGG + Intronic
1078454307 11:11463117-11463139 CAGTCTCCCACAAGAGAACAGGG + Intronic
1080821789 11:35814339-35814361 CAGTTCCTCACTAGGGAATTTGG + Exonic
1080933845 11:36841087-36841109 TACTTTCCCACAAGGAAAATAGG - Intergenic
1082609315 11:55279779-55279801 CTGTTTCCGCCATGGGAAGTTGG + Intergenic
1083072531 11:60000440-60000462 CAGATTCCCAAAAGGAAAGCAGG - Intergenic
1083262204 11:61529246-61529268 CAGGTTTCTACAGGGGAAGTTGG - Intronic
1083667771 11:64284986-64285008 TAGTTTCCCCCCAGTGAAGTGGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084723341 11:70923969-70923991 CAGTGTCTCACAAGGGCACTGGG - Intronic
1085204990 11:74726274-74726296 CAATTTCCCACAAAGGAAACAGG - Intronic
1087129077 11:94653312-94653334 CTCTTTCCCACAGGGGAATTGGG - Intergenic
1088162812 11:106893957-106893979 ATGATTCCCACAAGGGAAGGGGG + Intronic
1088923837 11:114281052-114281074 CAGGGTCCCACTAGGGACGTAGG + Intronic
1090033361 11:123226738-123226760 AAGTTTGCCACAAAGGAAGATGG - Intergenic
1092887400 12:12937032-12937054 CAGTTTCCCACAGAGGAAGCAGG + Intergenic
1094032778 12:26032272-26032294 CATTTTCCCCGAAAGGAAGTGGG + Intronic
1094382933 12:29863362-29863384 CAGGCTTCCTCAAGGGAAGTGGG + Intergenic
1095189463 12:39240057-39240079 CAGTTTCCCACGAGGCAATTGGG + Intergenic
1096483337 12:51958329-51958351 AATTTTCCCACAGGGGAAGTAGG + Intronic
1097376533 12:58849747-58849769 CAGGATCCCACAGGGGAAGCTGG - Intergenic
1098321448 12:69248455-69248477 AAGTTTCCCACAAGGGGTGTTGG - Intronic
1098897501 12:76080900-76080922 CAGTTTCCCACCAGGGGAGCTGG + Intronic
1105210590 13:18254634-18254656 CAGTTTCCCACCAGGAAAAGAGG + Intergenic
1105441818 13:20421552-20421574 CTGGCTCCCACAAGGGAAGAGGG + Intronic
1108005508 13:45942064-45942086 CATCTTTCCACAAGGCAAGTGGG + Intergenic
1108515573 13:51199623-51199645 GACTCTCCCACAAGAGAAGTAGG + Intergenic
1108568560 13:51726570-51726592 CAGATTCCCAGAAGGAAAGCAGG + Intronic
1113069261 13:106404054-106404076 CATTTTCCCACGAGGAAAGGGGG - Intergenic
1113277303 13:108745381-108745403 CAGGTTCCCACAAGGAAGATTGG + Intronic
1114578406 14:23734197-23734219 CTGTTTTCCACAGTGGAAGTCGG - Intergenic
1115762069 14:36584572-36584594 CAGCTTCTCACTAGGGAGGTGGG - Intergenic
1121422206 14:93824040-93824062 CATTTTCCCACATGGGAGATGGG - Intergenic
1121950789 14:98169516-98169538 CATTTTCCCAGAATGGGAGTTGG - Intergenic
1122301832 14:100735784-100735806 TTTTTTCCCAAAAGGGAAGTGGG - Exonic
1122562445 14:102625754-102625776 TGGTTTCCTAGAAGGGAAGTAGG + Intronic
1124170811 15:27371106-27371128 GAGTTTCCAACAATGGAACTTGG - Intronic
1125458166 15:39881860-39881882 TGGTTTCTCACAAGTGAAGTTGG + Intronic
1127295323 15:57604156-57604178 CAGTGTTCCCCAATGGAAGTAGG + Intronic
1128529393 15:68433347-68433369 CAGGTTCACATAAGTGAAGTGGG + Intergenic
1128915000 15:71551820-71551842 CAGACTCCCACAAGGAAAGCAGG + Intronic
1130255710 15:82325181-82325203 CAGTTTCCCTGAGGGGAAGGTGG + Intergenic
1130255930 15:82326063-82326085 CAGTTTCCCTGAGGGGAAGGTGG + Intergenic
1130599252 15:85264805-85264827 CAGTTTCCCTGAGGGGAAGGTGG - Intergenic
1131811367 15:96177092-96177114 CAGTTTTCCACAAGCGGATTTGG - Intergenic
1132180543 15:99749593-99749615 CATTTTCAGACAAGGGAAGCAGG + Intergenic
1134685685 16:16156575-16156597 CACTTTACCCCAAGGGAAGCTGG + Intronic
1135928628 16:26717565-26717587 AAGATTCCCAGAAGGGAATTTGG - Intergenic
1141025879 16:80547330-80547352 TTGTTTCTCAGAAGGGAAGTGGG + Intronic
1141423649 16:83932279-83932301 CAGGATCCCACAAGGAAAGGCGG + Intronic
1141744036 16:85913963-85913985 CAGACTCCCACAGGGGATGTAGG - Intronic
1143932861 17:10448828-10448850 CAGTTTCCCCCAAGGGGAGCTGG + Intronic
1144110280 17:12023828-12023850 CAGTTTCTCACTTGGAAAGTGGG + Intronic
1144713179 17:17416275-17416297 CACTTTGCCACAAGGGAGGCTGG + Intergenic
1145266425 17:21381658-21381680 CAGTGTCCCACAGGGGAATCAGG - Intronic
1145905671 17:28514830-28514852 CAGTTGCCCACAGGGGAGGCAGG + Intronic
1147568427 17:41552038-41552060 CAGTTTCCCATCTGGGAAGCTGG + Intergenic
1148550671 17:48548797-48548819 AAATTTCCCCCAAGGGAAGAAGG - Intergenic
1148805916 17:50263994-50264016 CAGCTTCCCAGAATGGAAGGTGG - Intergenic
1152133986 17:78493485-78493507 CAGTTTCCTAAAAAGGAACTCGG - Intronic
1156138532 18:34076208-34076230 CAGCTTCCCACTAGCAAAGTTGG + Intronic
1156892155 18:42203343-42203365 CAGTTTCCCACAAGATCAGCAGG - Intergenic
1157482703 18:48065796-48065818 CAGTTTCCCTCTAGGGCCGTTGG + Intronic
1157904162 18:51552852-51552874 CACTTACCCACAAAGGAAGATGG - Intergenic
1158595677 18:58813915-58813937 AAGTTTCCAAGAAGGGAAGATGG + Intergenic
1160389036 18:78516517-78516539 CAGATTCCCAAAAGAGAAGTGGG + Intergenic
1160915407 19:1494157-1494179 CAGTTTCCCCCTTGGTAAGTGGG - Intronic
1161109731 19:2462447-2462469 CAGTTTTCCATAATGGAAATGGG - Intergenic
1163069353 19:14825528-14825550 GAGTGTCCCTCAAGGGAACTTGG + Intronic
1163455952 19:17405754-17405776 CAGTTTCCCAGAAAGGAGGTGGG + Intronic
1164436570 19:28235749-28235771 CTGTTACTCACCAGGGAAGTTGG - Intergenic
1167570904 19:50288479-50288501 CTGTTTCCCACAAGGGCCTTTGG - Intronic
1167762915 19:51460648-51460670 AAGTTCACCACAAGGGAAGGGGG + Intergenic
926612835 2:14963553-14963575 CAGGTTCCCAGAAGGAAAGTAGG - Intergenic
927402444 2:22728872-22728894 CTGTTTTCCATAAGGGAACTTGG + Intergenic
931629856 2:64288973-64288995 CAGATTCCCACTAGGGAATCTGG - Intergenic
932558229 2:72844111-72844133 CAGCTTCTCAGTAGGGAAGTGGG - Intergenic
933983362 2:87571543-87571565 CAGTTTCCAAAAGAGGAAGTGGG + Intergenic
933996633 2:87674907-87674929 CAGCTTCCCAGAAGGCAAGGTGG - Intergenic
934713505 2:96530296-96530318 CTGTTTCCAACAAAGGTAGTTGG + Intergenic
934792787 2:97076650-97076672 CAGATGCCCACAAGAGAACTTGG + Intergenic
936297218 2:111276003-111276025 CAGCTTCCCAGAAGGCAAGGTGG + Intergenic
936310486 2:111379251-111379273 CAGTTTCCAAAAGAGGAAGTGGG - Intergenic
938256236 2:129861911-129861933 CAGCTTCCCACCAGGGTAGCTGG + Intergenic
938570030 2:132554429-132554451 CAGTTTCACACCAGGAAAATGGG + Intronic
941473570 2:165920899-165920921 CAGTTTCACTCAAGGGAAGTTGG - Intronic
941859759 2:170266877-170266899 CAGTTTTCCAGAAGGGAAACTGG + Intronic
943629222 2:190232359-190232381 CAGACTGCCAAAAGGGAAGTAGG - Intronic
946631569 2:221674703-221674725 AGGTTTCCCAGAAGGGACGTGGG + Intergenic
946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG + Intergenic
947124068 2:226849149-226849171 CAGTTTCCCACCATGTAAGATGG - Intronic
947481519 2:230504708-230504730 CAGATTCCCAGAAGGAAAGCGGG + Intronic
947991695 2:234493276-234493298 GGGTTTCCCATAGGGGAAGTTGG - Exonic
1169697380 20:8405592-8405614 CAGCTTCTCAGAAGGAAAGTGGG - Intronic
1169725542 20:8725133-8725155 CTGTTTCCCAGAAGGGAAGCAGG + Intronic
1171291727 20:23986325-23986347 CAGTTTCCCACCAGGAAAAGAGG + Intronic
1172760181 20:37316021-37316043 GAGTTTCACACAAGGTCAGTTGG + Intronic
1172861789 20:38060038-38060060 CAATTTCCCATAAGGAAAGCAGG - Intronic
1173537564 20:43827781-43827803 CAGACTCCCAGAAGGAAAGTAGG - Intergenic
1175063132 20:56261902-56261924 AAGTCTCCCACAAGAGAATTGGG + Intergenic
1177068119 21:16465259-16465281 CAGTTTCCTACCAGAAAAGTGGG + Intergenic
1177316709 21:19471621-19471643 CAGTTTCCCACAATGCTAGGTGG + Intergenic
1177935108 21:27335377-27335399 CAGTTTCCTACTAGGGATGCAGG + Intergenic
1179600202 21:42472291-42472313 AGATTTCCCACAAGGGAGGTAGG - Intergenic
1179721323 21:43317606-43317628 CAGCTTAACACAAGGGAAATTGG - Intergenic
1180157283 21:45983759-45983781 CAGTTTCCCACCTGTGAAATGGG + Intronic
1180765663 22:18344768-18344790 CAGTTTCCCACCAGGAAAAGAGG - Intergenic
1180780646 22:18517611-18517633 CAGTTTCCCACCAGGAAAAGAGG + Intronic
1180813366 22:18774931-18774953 CAGTTTCCCACCAGGAAAAGAGG + Intergenic
1181146990 22:20855775-20855797 CAGATTCCCAGAAGGAAAGCAGG + Intronic
1181199541 22:21209248-21209270 CAGTTTCCCACCAGGAAAAGAGG + Intronic
1181340994 22:22179909-22179931 CAGGTACCCACAAGTGAAGCAGG - Intergenic
1181400220 22:22646610-22646632 CAGTTTCCCACCAGGAAAAGAGG - Intronic
1181649146 22:24249180-24249202 CAGTTTCCCACCAGGAAAAGAGG + Intergenic
1181702193 22:24627708-24627730 CAGTTTCCCACCAGGAAAAGAGG - Intronic
1181943372 22:26496306-26496328 CAGTTTTCCACCTGCGAAGTGGG + Exonic
1181947571 22:26529945-26529967 CTGATTCCCACAAAGGGAGTGGG - Intronic
1183649862 22:39147625-39147647 CTGTTTCCCCCAAGTGAGGTGGG + Intronic
1184238770 22:43200623-43200645 CAGTCTCACACCAGGGAACTTGG - Exonic
1203227285 22_KI270731v1_random:85658-85680 CAGTTTCCCACCAGGAAAAGAGG - Intergenic
1203263468 22_KI270734v1_random:613-635 CAGTTTCCCACCAGGAAAAGAGG + Intergenic
949278334 3:2315373-2315395 CAGTTTCCCAAACGAGAAGTGGG + Intronic
950211236 3:11125109-11125131 CAGTTTCCCAAAAGGCCAGGTGG - Intergenic
951361974 3:21736083-21736105 AAGTTTCCCACCAAGGAAGAGGG - Intronic
951724736 3:25744669-25744691 CACTTAGCCGCAAGGGAAGTTGG - Intronic
951957013 3:28268521-28268543 CAGATTCCCAGAAGGAAAGCAGG + Intronic
952766159 3:36956087-36956109 CAGGCACCGACAAGGGAAGTAGG - Intergenic
953532716 3:43752732-43752754 CAGCTGCCCACATGGGGAGTGGG - Intergenic
955062778 3:55507620-55507642 CAGTTTCCAACAAGGGAAAATGG - Intergenic
955565499 3:60239952-60239974 CAGTTTCTCACAGGGAAAATAGG + Intronic
956138901 3:66126155-66126177 CAGTTGCCCACAGGGGTAGTTGG - Intergenic
956195502 3:66650076-66650098 CAGCTTCCCACAGGGGACATTGG + Intergenic
957251955 3:77783366-77783388 CACTTTTACACAAAGGAAGTAGG - Intergenic
960170060 3:114450111-114450133 CAGTTTTCCAGAAGGGAAAAAGG - Intronic
961272067 3:125696862-125696884 AAGTTTCCCACCAGAGACGTAGG + Intergenic
962649196 3:137471578-137471600 CAGACTCCCAGAAGGAAAGTAGG - Intergenic
962901331 3:139764491-139764513 AAATTTCTCACCAGGGAAGTAGG - Intergenic
963393657 3:144703555-144703577 CAGTGTCCCACAAAAGAAGGAGG - Intergenic
964309995 3:155382490-155382512 CAGGATCCCATAAGGAAAGTGGG + Intronic
967811546 3:193765250-193765272 CATTTGCCCACAAGGGAGGGAGG + Intergenic
968502881 4:959339-959361 CTGTGCCCCACAAGGGAAGGGGG + Exonic
973885720 4:55318966-55318988 AATTTTCCCATAAAGGAAGTTGG - Intergenic
975288724 4:72651177-72651199 CATGTTCCCACAAACGAAGTGGG - Intergenic
976394643 4:84543141-84543163 GAGCTTGCCACATGGGAAGTTGG + Intergenic
976571186 4:86613254-86613276 CAGATTCCCATAAGGAAAGCAGG + Intronic
978327069 4:107571243-107571265 CAGTTTCCCACAAGGAACAAAGG - Intergenic
978374691 4:108062402-108062424 CAGTTCCCCACATGGCAAGAGGG - Intronic
983514696 4:168643857-168643879 CAGTTTCCTAATCGGGAAGTAGG - Intronic
985089378 4:186347994-186348016 CAGTTTCTCACAAGGAAAGGCGG - Intergenic
986115013 5:4765196-4765218 CAGTTTCCCATGGGGGATGTAGG + Intergenic
986329409 5:6706564-6706586 CAGGTTTCCACCAGGGAGGTCGG - Intergenic
987309272 5:16667025-16667047 CAGTTTCCATCAAGCCAAGTTGG - Intronic
988114481 5:26867077-26867099 CAGATTCCCTCAAGGGATGAGGG + Intergenic
990051564 5:51507885-51507907 CACTTTCTCACCAGGGAAATGGG + Intergenic
990213383 5:53504599-53504621 CAGTTTCTCAGATGGGAAATAGG + Intergenic
992186625 5:74250558-74250580 TAGTGTCCCACTAGGGAAGTTGG - Intergenic
993396293 5:87393436-87393458 CAGTTTCCCACACTGAAAATGGG - Intronic
993771012 5:91926270-91926292 CATTTTGTCACAAGGGAAGATGG - Intergenic
994219229 5:97175515-97175537 CATTTTCCCAAAAGGGTAGTAGG - Intronic
995661790 5:114492433-114492455 CTTTTTCCCAAAAGAGAAGTAGG - Intronic
997209316 5:132068197-132068219 AGGTTTCCCTCATGGGAAGTGGG - Intergenic
1001009647 5:168086182-168086204 TACTTTCCCAGAAGGGAAGGTGG - Intronic
1001336683 5:170803419-170803441 CAGTTTCCTATCAGTGAAGTGGG + Intronic
1001588261 5:172848151-172848173 CATTTAACCACCAGGGAAGTAGG + Intronic
1003528353 6:6917100-6917122 CAGCTTCCCACCAGGGCAGCAGG - Intergenic
1005173464 6:23015191-23015213 CAGTTTGCCAGCAGTGAAGTAGG + Intergenic
1005822983 6:29613105-29613127 CAGTCTCCGACCAGAGAAGTAGG - Intronic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1012624740 6:101392508-101392530 CAGTTTCCCCCAGAGGAAGTTGG - Intergenic
1012927169 6:105279332-105279354 CAGTTTCCCACCAGATAAGATGG + Intronic
1012936708 6:105375690-105375712 CAGTTTCCCTCTTGGGAAGGAGG - Intronic
1014240485 6:119012668-119012690 CAGATTCCCAGAAGGAAAGCAGG + Intronic
1014607706 6:123498521-123498543 CATTTTCCCACAGGAGAGGTAGG + Intronic
1014693539 6:124591099-124591121 TAATTTCTCACAAGGGAAGTTGG - Intronic
1018117024 6:160596629-160596651 CATTTTCCAACAAGAGAAGAGGG - Intronic
1018453622 6:163932152-163932174 CAGTTTTGAACATGGGAAGTGGG - Intergenic
1018879212 6:167859439-167859461 CAGTTTCCTCCATGGGGAGTAGG + Intronic
1020494073 7:8824816-8824838 AAGTTTCCCAGAAGTGAAGGGGG - Intergenic
1021081998 7:16375686-16375708 CAGATTTCCAGAAGGAAAGTTGG - Intronic
1023203573 7:37724103-37724125 TGGTTACCTACAAGGGAAGTGGG - Intronic
1024318450 7:48042981-48043003 CAGGTTTCCAGATGGGAAGTAGG - Intronic
1028242793 7:88441340-88441362 AAGTTCCCCAAAATGGAAGTGGG + Intergenic
1031127485 7:117791407-117791429 CAGTTTGCCACAAGGGAACAGGG - Exonic
1031600105 7:123697743-123697765 CAGTTGACCACTTGGGAAGTTGG + Intronic
1031667246 7:124499701-124499723 AAGTTTGACAGAAGGGAAGTGGG + Intergenic
1036686440 8:10914712-10914734 CACTTTCCCACATGGGGAATTGG - Intronic
1037375792 8:18226280-18226302 CAGTTAACCACAAAGGAAGATGG + Intergenic
1037684467 8:21126859-21126881 CAGCTTCCCAGAATGGAAGCAGG + Intergenic
1040300370 8:46184857-46184879 AAGGTTCCCACAAGCGAAATGGG - Intergenic
1045816143 8:106278950-106278972 TAGTTTCCAACATGGGAGGTGGG + Intronic
1048123963 8:131612363-131612385 CAGCATCCCACAAAGTAAGTAGG + Intergenic
1048260888 8:132944160-132944182 CAGCTTCACAGAAGGGAAGAGGG - Intronic
1048863341 8:138740188-138740210 CATTTTCCCTCAAGGTCAGTGGG + Intronic
1048946716 8:139455536-139455558 CAGATTCCCAGAAGGAAAGCAGG + Intergenic
1049353071 8:142174584-142174606 CAGCTTCCCAGCAGGGGAGTGGG - Intergenic
1051645891 9:19268010-19268032 CACTTTCCCATAAAGGAAGATGG - Intronic
1052413902 9:28153150-28153172 CAATTTCCCAAAAGGCAATTTGG + Intronic
1053283927 9:36838577-36838599 CAGTTTCCCACAAGGGAAGTTGG + Exonic
1054997232 9:71406470-71406492 CAGTTTCTTACAAAGGAAGGTGG - Intronic
1057186760 9:93061436-93061458 CGGTTTTCCACCAGGGATGTGGG + Intronic
1059573436 9:115465390-115465412 CAGATTCCTAAAAGGGAAGGGGG + Intergenic
1061892548 9:133630314-133630336 CAGTTTCCTCCATGGGCAGTAGG - Intergenic
1062589361 9:137266557-137266579 CATTTTCCCAAAAGGAAGGTGGG - Intronic
1185512870 X:676334-676356 CAGTTTCCCAGCAAGGAACTGGG - Intergenic
1185856236 X:3538800-3538822 CTGTTTTTCACAATGGAAGTTGG - Intergenic
1187100499 X:16186486-16186508 CAGTTTCCCACAGTGGAAGCTGG - Intergenic
1187525242 X:20048216-20048238 CAGGTTCCCAGAAGGAAAGCAGG - Intronic
1190685853 X:52872494-52872516 CAGATTCCCAGAAGGGAAGCTGG - Intergenic
1190953743 X:55171550-55171572 CAGGTCCCCACTAAGGAAGTTGG - Intronic
1191150811 X:57219738-57219760 GAGTTTCCCATAAGGGAGGGTGG - Intergenic
1193019113 X:76770513-76770535 CACATTCCCACCAGGGAACTGGG + Intergenic
1193775679 X:85638562-85638584 CAGTTTCATACAAGGGATGCAGG - Intergenic
1195351577 X:104001391-104001413 CAGTTTTACACAAGAAAAGTTGG + Intergenic
1195405986 X:104513912-104513934 CAGTGACCCAAAAGGGAAATAGG - Intergenic
1198686771 X:139235778-139235800 CAGTTTCTCAAAAGAGAGGTGGG - Intergenic
1198695654 X:139334153-139334175 CAGTAACCGTCAAGGGAAGTGGG - Intergenic