ID: 1053285703

View in Genome Browser
Species Human (GRCh38)
Location 9:36848333-36848355
Sequence GTGTGGACACGCTCTGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053285703_1053285706 24 Left 1053285703 9:36848333-36848355 CCACAGGCAGAGCGTGTCCACAC 0: 1
1: 0
2: 0
3: 14
4: 130
Right 1053285706 9:36848380-36848402 ACATGCTCGCGCTCCTCCTCGGG No data
1053285703_1053285705 23 Left 1053285703 9:36848333-36848355 CCACAGGCAGAGCGTGTCCACAC 0: 1
1: 0
2: 0
3: 14
4: 130
Right 1053285705 9:36848379-36848401 CACATGCTCGCGCTCCTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053285703 Original CRISPR GTGTGGACACGCTCTGCCTG TGG (reversed) Intronic
900169520 1:1259773-1259795 GTGGGGCCACGCTGTGACTGTGG - Intronic
900620558 1:3585158-3585180 GTGTGGACACGTCCTGTGTGTGG + Intronic
900620607 1:3585584-3585606 GTGTGGACACGTCCTGTGTGTGG + Intronic
900620646 1:3585892-3585914 GTGTGGACACGTCCTGTGTGTGG + Intronic
901872291 1:12145170-12145192 GGGTGGACAGGGTCTGTCTGTGG - Intergenic
903754608 1:25652143-25652165 GTGTGGACACTCTTGTCCTGGGG + Intronic
904044496 1:27601905-27601927 GTGAGGACAAGCTTTGCCTCCGG - Intronic
904206853 1:28861155-28861177 CTGTGGACCCACTCTGTCTGTGG + Intronic
904807894 1:33144695-33144717 GTTAGGACAGGCTCTGCATGTGG - Intergenic
904959343 1:34319268-34319290 GTGAGGAAAAGCTCTTCCTGTGG - Intergenic
905271073 1:36787817-36787839 GTGCGGACACGCTGTGGCAGAGG + Intergenic
906513793 1:46426250-46426272 AGGTGGCCAGGCTCTGCCTGAGG - Intergenic
907336437 1:53702714-53702736 GTGTCGACAAGGTCTGCCTTGGG + Intronic
907719141 1:56955059-56955081 GTTTGGACTCTCTCTCCCTGGGG + Intronic
912933422 1:113983357-113983379 GTCTGGAGCAGCTCTGCCTGAGG - Intergenic
916148872 1:161766531-161766553 GTGTGGACCAACCCTGCCTGGGG + Intronic
919824842 1:201496112-201496134 GTGTTGACAGGCCCAGCCTGTGG + Intronic
1063218981 10:3948909-3948931 GTGAGGACACACTCTGGCTTCGG - Intergenic
1065465580 10:26017302-26017324 GTGTTGAGTCACTCTGCCTGGGG + Intronic
1069855089 10:71435802-71435824 GTGAGGTCAGGCTCTCCCTGGGG + Intronic
1070366673 10:75743358-75743380 CTGTGTACACGCTCTGCCCGTGG + Intronic
1076076411 10:127537280-127537302 GTGGGGTCACGCTCTGGCTGGGG + Intergenic
1076724458 10:132407020-132407042 GTGTGGATTCTCTGTGCCTGGGG + Intronic
1077118087 11:894421-894443 GTGTGCACACGGCCGGCCTGGGG - Intronic
1077233301 11:1468298-1468320 GTGGGGCCACCCTCTGGCTGAGG - Intergenic
1078388000 11:10909724-10909746 GTGAGAACACACTCTGCCTCAGG + Intergenic
1078421758 11:11218421-11218443 TTGTGGTCACGCTCTGTCAGAGG - Intergenic
1084085113 11:66851417-66851439 GTGTGGCCACCCCCCGCCTGTGG - Intronic
1084438039 11:69155476-69155498 GTGTGGACACCATGTGACTGGGG + Intergenic
1085777927 11:79382954-79382976 GAGCAGGCACGCTCTGCCTGTGG + Intronic
1090081321 11:123614791-123614813 GCTTGGACACGCTCTGCAGGTGG - Exonic
1095345465 12:41143968-41143990 CTGTGGACACGCTATGTTTGTGG - Intergenic
1096111598 12:49032143-49032165 GTCTGGGCAGGGTCTGCCTGGGG - Exonic
1104293039 12:127486500-127486522 GTGGGTACAAGCTCTCCCTGTGG + Intergenic
1104921903 12:132295005-132295027 GTGTGGAGACGCCCGGCCTGCGG + Intronic
1106481064 13:30137095-30137117 GAGGGCACATGCTCTGCCTGAGG - Intergenic
1108382977 13:49871856-49871878 GTGTCGACAGGCCCTTCCTGAGG - Intergenic
1119545574 14:75469220-75469242 CTGGGGAGAGGCTCTGCCTGTGG - Intronic
1119607814 14:76035803-76035825 ATGTGGGCACACCCTGCCTGTGG + Intronic
1122208606 14:100160582-100160604 GGGTGGACCTGCTGTGCCTGTGG + Intergenic
1123707946 15:22964244-22964266 GAGTGGACTCACTCTGCATGGGG - Intronic
1127704758 15:61535747-61535769 GTGTTCACCCGCCCTGCCTGAGG - Intergenic
1128708158 15:69852323-69852345 GTGAGAACACTCACTGCCTGGGG - Intergenic
1129032310 15:72628371-72628393 GTCTGGACACCCTCACCCTGTGG + Intergenic
1133882564 16:9796769-9796791 GAGTGGAGAAGCTCTGCCTGGGG - Intronic
1134122685 16:11596289-11596311 CTGAGAACACGCTCTTCCTGCGG - Intronic
1136042051 16:27587281-27587303 GTGTGGACAGGATCTGACAGAGG - Intronic
1138101132 16:54253184-54253206 GTGTGGAGAGGCACTGGCTGGGG - Intronic
1139191832 16:64873104-64873126 GGATGGACACACTCTGCCTTTGG - Intergenic
1139638828 16:68276171-68276193 TTGTAAACAAGCTCTGCCTGCGG + Intronic
1142217556 16:88837343-88837365 GTGTGGGCTCGCTCTGCTGGGGG + Intronic
1143057806 17:4175563-4175585 GTGTGTACAGGCACTGCCTCTGG + Intronic
1143371724 17:6444620-6444642 GTTCGGACACGCACGGCCTGTGG + Intronic
1145666705 17:26384065-26384087 GTTTGGAAACGCTCTTCTTGTGG + Intergenic
1146768738 17:35548634-35548656 GTGTGCCCAGGCTCTGCCTGGGG - Exonic
1146969236 17:37059051-37059073 CTCTGGGCACACTCTGCCTGTGG + Intergenic
1147927522 17:43954685-43954707 GGGTGGAGACACTCTGCCTTGGG - Intronic
1149793850 17:59501367-59501389 GAATGCACACGCTCTTCCTGGGG - Intergenic
1152586388 17:81191338-81191360 GGGGGGACATGCGCTGCCTGGGG + Intronic
1152609762 17:81309831-81309853 ATGTGGATAAGCCCTGCCTGGGG - Intergenic
1152610613 17:81313498-81313520 GTGGGGACCCACTCAGCCTGTGG - Exonic
1152644137 17:81461080-81461102 GTGTGGCCACGCTGTGCACGGGG - Exonic
1152756007 17:82087343-82087365 GTGTGTACAGCTTCTGCCTGTGG + Exonic
1153617415 18:6947575-6947597 CTGTGGACACGTCCTCCCTGCGG + Intronic
1156480904 18:37435832-37435854 GTCTTGCCAGGCTCTGCCTGGGG - Intronic
1156964800 18:43078276-43078298 GTGGGGACAGGCTCAACCTGTGG - Intronic
1159268855 18:66122397-66122419 GTGTGGACAACCTCTTACTGAGG + Intergenic
1159988760 18:74877118-74877140 GTTCGCACACGCGCTGCCTGGGG + Intronic
1160795011 19:941174-941196 GCGGGGACACTCTCTGCCTGCGG - Intronic
1162633102 19:11944328-11944350 GTGTGTACAAGCTCTCCCTGTGG - Intronic
1164671449 19:30074388-30074410 GCGTGTTCACGCTATGCCTGAGG - Intergenic
1165088895 19:33372198-33372220 GTGTGGTGGCGCTGTGCCTGTGG - Intergenic
929762980 2:44821281-44821303 CCTTGGACACCCTCTGCCTGGGG + Intergenic
930021622 2:47005139-47005161 GTGTGGGGAAGCTCTCCCTGGGG + Intronic
937369776 2:121289111-121289133 GTGTGCACACGCTTTCCCTCTGG - Intergenic
942824901 2:180163828-180163850 GTGTAGATACACTCTGACTGGGG + Intergenic
944862017 2:203824201-203824223 GTGTACACATGCTCTTCCTGTGG - Intergenic
946348378 2:219129780-219129802 GTGTGGACACACGGTGCCCGGGG - Intronic
948181994 2:235989513-235989535 GTGTGCCCAGGCCCTGCCTGGGG - Intronic
948293874 2:236846865-236846887 ATGAGGGCACGCTCTGGCTGTGG + Intergenic
948718235 2:239880133-239880155 CTTTGCACAAGCTCTGCCTGTGG - Intergenic
1171752188 20:29062518-29062540 CTGAGGACTGGCTCTGCCTGAGG - Intergenic
1171790142 20:29515347-29515369 CTGAGGACTGGCTCTGCCTGGGG + Intergenic
1172774305 20:37398200-37398222 GTGTGGACACGCACTGGGTCAGG - Intronic
1176239985 20:64071504-64071526 GTCAGAACAGGCTCTGCCTGTGG + Intronic
1179628192 21:42660255-42660277 GTGCAGACACGCTTTGTCTGGGG - Intronic
1180390846 22:12280468-12280490 CTGAGGACTGGCTCTGCCTGGGG + Intergenic
1180408897 22:12584289-12584311 CTGAGGACTGGCTCTGCCTGGGG - Intergenic
1181646384 22:24233504-24233526 GTGTGCACAGGCTCTGCCACTGG - Exonic
1183272624 22:36871646-36871668 GTGGGGACACGCTCTTGCTGTGG - Exonic
953543571 3:43843588-43843610 GTGGGGACACCCTGTGCCTGTGG + Intergenic
954132499 3:48567683-48567705 GTGTGGGCACGCTCAGAATGAGG - Intronic
957022623 3:75141874-75141896 GTGGGTACAAGCTCTCCCTGTGG + Intergenic
961388595 3:126538436-126538458 ATGTGGCCTGGCTCTGCCTGAGG - Intronic
967321282 3:188197655-188197677 GTGAGGTCATGCTATGCCTGGGG + Intronic
967946150 3:194805751-194805773 CCGTGGACTGGCTCTGCCTGTGG + Intergenic
969217645 4:5734998-5735020 CTGTGGACACTCGCTGGCTGTGG - Intronic
969317355 4:6390231-6390253 GGGTGCACACACTGTGCCTGGGG + Intronic
970710275 4:18853725-18853747 CTGTGGACAGGCTTTGACTGTGG - Intergenic
978142386 4:105332663-105332685 GAGTTGACATGCCCTGCCTGTGG + Intergenic
985761427 5:1751250-1751272 GTGTGCACACTCTCAGCTTGGGG - Intergenic
986668854 5:10126179-10126201 GTCTGGAAATGCCCTGCCTGTGG - Intergenic
999736896 5:154519503-154519525 GTGTGTACACGCTCAGTCTCTGG + Intergenic
1000539742 5:162525455-162525477 GTGTGGATAGGCACTGGCTGTGG + Intergenic
1002467775 5:179416349-179416371 GTGTGGACAAGATCTGGGTGTGG - Intergenic
1003016283 6:2469982-2470004 AGGAGGACACGCTCTTCCTGGGG + Intergenic
1004268682 6:14173938-14173960 GTGTGGCCACGCTTAGTCTGAGG + Intergenic
1004569551 6:16832164-16832186 GGCTGGACAAGCTCAGCCTGGGG - Intergenic
1005284264 6:24308063-24308085 GTGTGGACTTGCTCTGCATCTGG - Intronic
1006525136 6:34597835-34597857 CTGTGAACACACCCTGCCTGTGG + Intronic
1007244059 6:40447258-40447280 GTGGGGACATGCTTTGCTTGAGG - Intronic
1010236563 6:73579686-73579708 GTGTGGACCTGGTCTCCCTGGGG + Intergenic
1012900589 6:105001255-105001277 GTGTCTACATGCTCTGCCTGTGG + Intronic
1014865707 6:126527039-126527061 GTGTAGACACTGTCTGCCTGTGG + Intergenic
1018215891 6:161527536-161527558 CTGTGGCCTCTCTCTGCCTGAGG + Intronic
1018914670 6:168125710-168125732 GTGTGGCCACGCTCACCCCGGGG - Intergenic
1019425227 7:972272-972294 GTGAGGCCACGTTCTGCCTTTGG - Intronic
1019658143 7:2208963-2208985 GTGTGGACACCCTCATCCTTAGG - Intronic
1023866314 7:44240096-44240118 GTCTGGACAAGCTGTACCTGTGG - Intronic
1025250759 7:57349909-57349931 GTGAGGACGCCCCCTGCCTGTGG - Intergenic
1029579269 7:101424681-101424703 GGGTGCACACCCTCTGTCTGTGG + Intronic
1031401283 7:121328814-121328836 GTCTGGACACGCTGTCCCTGAGG + Intronic
1034366349 7:150551783-150551805 GTGTGCACACTCTTTGGCTGTGG - Intergenic
1034412616 7:150949130-150949152 GAGGGGACATGCTCTGCCCGGGG - Intronic
1037287677 8:17318542-17318564 GTCTGGACTCGCTCTTCCTGTGG + Intronic
1040413668 8:47179657-47179679 GAGGGGACACGCGCTGCCGGGGG + Intergenic
1040819288 8:51537274-51537296 GGCTGGACACCCTCTGGCTGGGG + Intronic
1040969113 8:53114539-53114561 GCGTGGACCAGCTCTGCCTGGGG + Intergenic
1041695559 8:60732468-60732490 CTGTGGCCATGCTCTGTCTGGGG - Intronic
1042370130 8:67982138-67982160 GTGTGGATAGCCTCTGCATGCGG + Intronic
1043291738 8:78610680-78610702 GTGTGTACATGCTAAGCCTGAGG + Intergenic
1049214369 8:141401011-141401033 GTGAGGACAGGCTCCTCCTGGGG + Intronic
1049245801 8:141561830-141561852 GTCTGGACATGCACTGCATGTGG - Intergenic
1049409957 8:142468617-142468639 GTGGAGGCACGCTCTGCCTCAGG + Intronic
1050171553 9:2824732-2824754 GAGTGGCCATGCACTGCCTGTGG - Exonic
1050361240 9:4832993-4833015 GAGTGGGCTGGCTCTGCCTGAGG - Intronic
1053285703 9:36848333-36848355 GTGTGGACACGCTCTGCCTGTGG - Intronic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1060196636 9:121628343-121628365 GTGTGAACAGACTCTGCCTCTGG + Intronic
1062177917 9:135174589-135174611 GTGTGGCCACCCTCTGCCGCTGG + Intergenic
1203451491 Un_GL000219v1:120992-121014 ATGAGGACTGGCTCTGCCTGGGG + Intergenic
1185609493 X:1386055-1386077 ATGGGGCCACGCTCTGCCCGTGG - Intergenic
1190873881 X:54446211-54446233 GAGGGGACACGTTCTGCCCGGGG - Exonic
1197961134 X:132007218-132007240 GTGAGAACAGGCACTGCCTGGGG + Intergenic
1200909293 Y:8516354-8516376 GTGTGTGCACCATCTGCCTGTGG + Intergenic