ID: 1053286328 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:36851717-36851739 |
| Sequence | CTGCATGAGCAAAGGCAGGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1053286324_1053286328 | -10 | Left | 1053286324 | 9:36851704-36851726 | CCAGAGGAGGCAACTGCATGAGC | 0: 1 1: 0 2: 1 3: 14 4: 157 |
||
| Right | 1053286328 | 9:36851717-36851739 | CTGCATGAGCAAAGGCAGGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1053286328 | Original CRISPR | CTGCATGAGCAAAGGCAGGG AGG | Intronic | ||
| No off target data available for this crispr | |||||