ID: 1053286328

View in Genome Browser
Species Human (GRCh38)
Location 9:36851717-36851739
Sequence CTGCATGAGCAAAGGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053286324_1053286328 -10 Left 1053286324 9:36851704-36851726 CCAGAGGAGGCAACTGCATGAGC 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053286328 Original CRISPR CTGCATGAGCAAAGGCAGGG AGG Intronic
No off target data available for this crispr