ID: 1053286579

View in Genome Browser
Species Human (GRCh38)
Location 9:36853329-36853351
Sequence TTCTATTAATATATCTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 419}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053286579_1053286583 24 Left 1053286579 9:36853329-36853351 CCTACCAAGATATATTAATAGAA 0: 1
1: 0
2: 2
3: 29
4: 419
Right 1053286583 9:36853376-36853398 ATTCTCTCATACTGAAGAAGGGG No data
1053286579_1053286581 22 Left 1053286579 9:36853329-36853351 CCTACCAAGATATATTAATAGAA 0: 1
1: 0
2: 2
3: 29
4: 419
Right 1053286581 9:36853374-36853396 AAATTCTCTCATACTGAAGAAGG No data
1053286579_1053286582 23 Left 1053286579 9:36853329-36853351 CCTACCAAGATATATTAATAGAA 0: 1
1: 0
2: 2
3: 29
4: 419
Right 1053286582 9:36853375-36853397 AATTCTCTCATACTGAAGAAGGG No data
1053286579_1053286584 25 Left 1053286579 9:36853329-36853351 CCTACCAAGATATATTAATAGAA 0: 1
1: 0
2: 2
3: 29
4: 419
Right 1053286584 9:36853377-36853399 TTCTCTCATACTGAAGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053286579 Original CRISPR TTCTATTAATATATCTTGGT AGG (reversed) Intronic
901274797 1:7982838-7982860 CTCTATTCATTTATTTTGGTGGG + Intronic
902413154 1:16223820-16223842 CTCTGTTAAAATATCTTGTTTGG + Intergenic
904822240 1:33253323-33253345 TGCTATTAATATGATTTGGTTGG - Intergenic
905687007 1:39915525-39915547 GGCTGTTAATATATCTTGTTTGG + Intergenic
905703767 1:40039671-40039693 TTCTAGAAATAAATCTTTGTGGG + Intergenic
906180814 1:43817279-43817301 TTCTTTTTATTTATCTTGATTGG + Intronic
907173258 1:52492022-52492044 ATCTACTTATATATCTTGGATGG + Intronic
907585288 1:55611482-55611504 TTGTAATAAAACATCTTGGTCGG - Intergenic
908439079 1:64135380-64135402 TTCAATTTATATCTCTTGGGAGG - Intronic
908467490 1:64412156-64412178 TTCTTTTAATTTATCTTTCTAGG + Intergenic
909005108 1:70266559-70266581 GTCTATAAAAATATCTTGCTGGG + Intronic
909081558 1:71118567-71118589 TGCTATTAAAATATCTTAGAAGG + Intergenic
909147491 1:71955271-71955293 TGCCATTAATATTTTTTGGTAGG - Intronic
909869097 1:80716824-80716846 TTCTTTTAAAAAATGTTGGTTGG - Intergenic
910004261 1:82376526-82376548 TTCTTTAAATTTATCTTGCTTGG + Intergenic
911300860 1:96171980-96172002 TTCCATTGATATATCATGTTTGG - Intergenic
911585664 1:99687781-99687803 TTCACTAAATATATCATGGTAGG + Intronic
913028509 1:114872211-114872233 TTCTTTTAACATTTCTTGGAAGG + Intronic
913033947 1:114942065-114942087 TTCTTTTAATTTTTCTTGCTTGG - Intronic
913471374 1:119190640-119190662 TTCTATTACTCCATCTTGGCCGG + Intergenic
915778571 1:158519465-158519487 TTATATTAATCCATCTTGATAGG - Intergenic
915821816 1:159031772-159031794 TTCTCCTAATATATCTTAATAGG - Intronic
916232547 1:162554736-162554758 TACTGTTAAAAAATCTTGGTGGG + Intergenic
916267724 1:162907693-162907715 CTCTATTAATATTTGTTGGATGG - Intergenic
916685198 1:167137971-167137993 TACTATTAATATATTTTAATAGG + Intergenic
916925715 1:169518480-169518502 TTCGTTTAAGAAATCTTGGTGGG - Exonic
917387956 1:174498237-174498259 TTCTATAAATATATGTAGTTAGG - Intronic
917586191 1:176429064-176429086 TTATATTAAGATATCTTTATTGG + Intergenic
918960924 1:191276462-191276484 TTGTTTTAATATATATTTGTTGG + Intergenic
919256428 1:195130195-195130217 TTCTAATAATATTTTTTGGGTGG - Intergenic
919667320 1:200304450-200304472 GTGTATTAATAAATCTTGCTTGG - Intergenic
921637504 1:217513604-217513626 TTCTGTAAATACATCTTTGTTGG - Intronic
921665199 1:217861332-217861354 TTCTTTTAACATATCTTGCAAGG + Intronic
921674064 1:217957609-217957631 TTCTTTTAATATTTCTTGCCAGG - Intergenic
923379854 1:233406100-233406122 TTCCATTTTTATATTTTGGTGGG + Intergenic
924413775 1:243835601-243835623 TGGTATTAAAATTTCTTGGTGGG - Intronic
924723153 1:246642710-246642732 TACTATTAATATATATTTCTAGG + Intronic
1062847167 10:716797-716819 TTCTAGTAATTTATCTAGATTGG + Intergenic
1063002922 10:1941515-1941537 TTCTATTTTTATTTTTTGGTGGG + Intergenic
1063471243 10:6287930-6287952 TTCTTTTAATATTTCTTGCAAGG + Intergenic
1063772350 10:9218001-9218023 TTGCATTTGTATATCTTGGTTGG - Intergenic
1063828489 10:9925462-9925484 TTATATTAAAATATTTGGGTTGG - Intergenic
1064859100 10:19806288-19806310 TTCTTTTAGTATTTCTTGTTGGG - Intergenic
1065451162 10:25858854-25858876 TTCTCTTAGTATATCTTGTAGGG + Intergenic
1066041828 10:31556198-31556220 TTCTTTTAACATTTCTTGCTAGG - Intergenic
1066545593 10:36496919-36496941 TTCTGTTATTATTTCTGGGTGGG - Intergenic
1067128195 10:43538354-43538376 ATTTATTAATATTTCTTGCTAGG - Intergenic
1068190653 10:53647897-53647919 TTCTATTGCTATATCTTGGAGGG - Intergenic
1068481174 10:57590475-57590497 TTCTATTTTTTTTTCTTGGTGGG + Intergenic
1068543034 10:58317124-58317146 TTCTCTCAATATAGATTGGTAGG - Intergenic
1069010915 10:63370768-63370790 TTCTGTTAATATACTTTGATAGG - Intronic
1070277812 10:75024321-75024343 TTCTATTAAAATATTTTGCCAGG + Intronic
1070953743 10:80451233-80451255 ATCTATTAATATATCCTAGTGGG + Intergenic
1071593576 10:86900576-86900598 TTTCATTAATGTATCTAGGTTGG - Intronic
1071726854 10:88207385-88207407 TGCTATTCATATATCTTGATTGG - Intergenic
1071728996 10:88229157-88229179 TTCTATTAATAGAAATTGTTAGG - Intergenic
1071769405 10:88708802-88708824 TTATATTAAAATATATTTGTAGG - Intergenic
1072194922 10:93109280-93109302 TTCCATTACTCTTTCTTGGTTGG + Intergenic
1072841650 10:98781199-98781221 TTTTATTAATACATCTTGCTTGG + Intronic
1073625944 10:105097011-105097033 TTCTTTTAATATATACTGGATGG + Intronic
1073845988 10:107555304-107555326 TTCTATTACTTCAGCTTGGTAGG + Intergenic
1075133093 10:119757362-119757384 TCATATTAATAAATCTCGGTCGG - Intronic
1078036479 11:7810667-7810689 TAATATTAATATTTCTTGCTAGG + Intergenic
1078816393 11:14826633-14826655 TTTTATTTATTTATTTTGGTTGG - Intronic
1079481446 11:20884853-20884875 TTCAATAAATATTTGTTGGTTGG + Intronic
1079717991 11:23772391-23772413 TTCCTTGTATATATCTTGGTTGG + Intergenic
1079789276 11:24715315-24715337 ATTTCTAAATATATCTTGGTCGG + Intronic
1080783469 11:35452991-35453013 TTCAATAAATATTTGTTGGTGGG + Intronic
1081251565 11:40841795-40841817 TTCTATTTAGCAATCTTGGTTGG - Intronic
1082712925 11:56576556-56576578 TTCTATGAATATAAATTGTTTGG - Intergenic
1085244279 11:75086542-75086564 TTCTATCCATATATCTTTTTTGG - Intergenic
1085247562 11:75115938-75115960 TTCTTTTTATTTATCTTGCTTGG + Intronic
1085425535 11:76401476-76401498 TTCTGTTAATTTATCTTGCCGGG + Intronic
1085871907 11:80360174-80360196 TTCTATTAATTTCTCTTGTGTGG + Intergenic
1086979773 11:93181605-93181627 TTTTATTTATATATATTGTTAGG + Intronic
1087133111 11:94686083-94686105 TTTTCTTAATTTATCTTGTTTGG - Intergenic
1087343935 11:96945182-96945204 TTCTGTTAATATTTCTTGTCAGG - Intergenic
1087483188 11:98727847-98727869 TTTTTTTAATAAATCTTGATTGG - Intergenic
1087730449 11:101772647-101772669 TTATATCAAGATATCTTGATAGG + Intronic
1087964586 11:104397042-104397064 TTTTATTAATATATTTTATTTGG - Intergenic
1088048153 11:105478735-105478757 TTCAATTAAGATATATTGATTGG - Intergenic
1088701726 11:112419202-112419224 ATCTATTAATACATATTGGAGGG - Intergenic
1090157468 11:124456192-124456214 TTCTATTAATACATATTTTTTGG + Intergenic
1090299557 11:125623763-125623785 TACTATTAAAATATTTTAGTGGG + Intronic
1090446614 11:126770007-126770029 TCCCATTAAAATATCCTGGTTGG + Intronic
1090717532 11:129443361-129443383 TTCTATTTTTAGCTCTTGGTGGG - Intronic
1091859483 12:3767269-3767291 TTCTTTTAATATTTCTTGTAAGG - Intergenic
1091859772 12:3770453-3770475 TGCTATTAATATGTCTTCTTTGG - Intergenic
1092500950 12:9046722-9046744 TTCTTTTAACATTTCTTGGAAGG - Intergenic
1093275921 12:17126484-17126506 TTTTATAAATATATTTTAGTAGG + Intergenic
1093837741 12:23857282-23857304 TTCTATTAAAGTAGCTTGTTAGG + Intronic
1094615767 12:32034929-32034951 TTTTATTTATTTATTTTGGTGGG + Intergenic
1096340797 12:50797269-50797291 TTCTATTAATTTATCTTGTTTGG - Intronic
1096764599 12:53873720-53873742 TTTTATTTATTTATCTTGCTTGG - Intergenic
1097416104 12:59318285-59318307 TTCTATCTATATATCCTGTTAGG + Intergenic
1098064554 12:66599823-66599845 TTCTATAAATTTATCTTTCTGGG - Intronic
1099444475 12:82735668-82735690 ATGTATTCATTTATCTTGGTCGG + Intronic
1099630517 12:85136974-85136996 TTCTCTAAATACATCTTGCTTGG - Intronic
1099701711 12:86092290-86092312 TAATATTTATATATCTTGGAAGG + Intronic
1099956740 12:89358517-89358539 TTCTATTAATATATTCTTGGGGG - Intergenic
1100008011 12:89917475-89917497 TTCTATTAAATTATATTAGTTGG - Intergenic
1100029698 12:90171136-90171158 TACTATTAGTAATTCTTGGTGGG + Intergenic
1100560186 12:95740456-95740478 AAATATTAATATATCTTGTTGGG - Intronic
1101483120 12:105122010-105122032 TTATATTTATATTTCTTGTTTGG - Intronic
1102743550 12:115229685-115229707 TGTTATGAATATATCTGGGTAGG - Intergenic
1103111112 12:118279313-118279335 TATTATTAATAGATCTTTGTTGG + Intronic
1105294976 13:19080254-19080276 TTCTTTTAATATTTCTTGCAAGG - Intergenic
1105566671 13:21556006-21556028 ATCTTTTAATATGTGTTGGTAGG - Intronic
1106047170 13:26153505-26153527 TTCTTTTAAAATATCTTGACTGG - Intronic
1106363500 13:29054195-29054217 TTGTATTCATATATCTTCTTTGG + Intronic
1106789434 13:33139571-33139593 TTCTATTTCTATTTCTTGGATGG + Intronic
1107322434 13:39203888-39203910 TTCTTTAAATATACCCTGGTGGG - Intergenic
1107730851 13:43346800-43346822 TTCTCCTAACATATATTGGTGGG - Intronic
1107870418 13:44741468-44741490 TTCTTTTAAAAAATCTTTGTTGG + Intergenic
1108479381 13:50852846-50852868 TTCTATTAATATCTCGTTGGTGG + Intergenic
1109792046 13:67261770-67261792 TATCATTAATATATCTTGATGGG - Intergenic
1109878944 13:68445576-68445598 ATTTATTGATATATTTTGGTAGG + Intergenic
1109916833 13:69000033-69000055 TTTTTTTTATATATCTTTGTTGG - Intergenic
1110017041 13:70418865-70418887 TTCTAAAAATATATCTTTGAAGG + Intergenic
1110367468 13:74702954-74702976 TTATATTTATATAAATTGGTAGG - Intergenic
1110865689 13:80392990-80393012 TTCTCTTAATATACTGTGGTAGG + Intergenic
1111276650 13:85957045-85957067 TTCTAAAAATAAATATTGGTGGG + Intergenic
1112540952 13:100312210-100312232 TAATATTAATATAGCTTTGTAGG + Intronic
1112850465 13:103699894-103699916 TTCAAATATTATATCTGGGTGGG - Intergenic
1113157810 13:107344820-107344842 TTCTACTATTTTATCTTGGTAGG - Intronic
1113869239 13:113548004-113548026 TGCTATTAATCTAGTTTGGTTGG + Intronic
1115052788 14:29084936-29084958 TTCTATTAATATATATAGACAGG + Intergenic
1115712349 14:36064509-36064531 TTCTAATATTATATCTTTGATGG - Intergenic
1116136974 14:40938195-40938217 TTATATAAATATATATTAGTAGG + Intergenic
1116349027 14:43835211-43835233 TTCTAGTAATATATCAAGATTGG + Intergenic
1117430195 14:55650260-55650282 TGCTATTTTTATATCTTGGTGGG + Intronic
1118695249 14:68378397-68378419 CTCTATTAATGTTTCTTTGTTGG + Intronic
1119023573 14:71135419-71135441 TACTATTAATATATCCTGTGGGG - Intergenic
1119839075 14:77777470-77777492 TTATATTATTATATCATTGTTGG - Intergenic
1120126216 14:80746940-80746962 GGCTATTTATATATCTTCGTTGG - Intronic
1120377097 14:83723170-83723192 TTCTACTAAGATATCTTCCTTGG + Intergenic
1120955103 14:90075038-90075060 TTTTATTATTTTATCTTTGTAGG + Intronic
1121633105 14:95435683-95435705 TTCTTTTTATTTATCTGGGTTGG - Intronic
1122617178 14:103027040-103027062 TTGTATTAATATATCTTCTTTGG - Intronic
1123689461 15:22824791-22824813 TACTATTAAAATGTCTTGGGTGG - Exonic
1123810184 15:23916871-23916893 TTCTATTAATATTTCTTTCTTGG - Intergenic
1125019698 15:34972338-34972360 TGCTATTCATATATCTTCTTTGG + Intergenic
1125179068 15:36860778-36860800 TACTATTGGTATATCATGGTAGG + Intergenic
1125800146 15:42438515-42438537 TTCTATAAATATATTTAAGTAGG + Intronic
1125874048 15:43128547-43128569 TAATATTAATATTTCTTGCTAGG - Intronic
1126042393 15:44604630-44604652 TTTTATAAATATGTATTGGTTGG + Intronic
1126402314 15:48284925-48284947 TACAAGTAATATATTTTGGTTGG - Intronic
1126947451 15:53838108-53838130 TTCCATGAAAATATCTTGTTGGG + Intergenic
1127232521 15:57012428-57012450 TTCTACTTATATATCTTAATAGG - Intronic
1128380954 15:67112087-67112109 TTCCATTTGTATATCTTGTTTGG + Intronic
1130571574 15:85050103-85050125 TTTTATTAATATATCTTCTTTGG + Intronic
1131226086 15:90625355-90625377 TTTTAAAAATATATCTTGGAAGG + Intronic
1132022822 15:98378310-98378332 TTCTTTTAATATTTCTTGCAAGG - Intergenic
1132137717 15:99359786-99359808 TTCTCTAAATCTATCTTGATTGG + Intronic
1132477299 16:146983-147005 ATCTATTAATATTTCCTTGTAGG - Intergenic
1137019761 16:35414134-35414156 TTTTATTTATTTATTTTGGTTGG + Intergenic
1137225912 16:46508595-46508617 TTCTATTTATGTATTTTGATTGG - Intergenic
1138065201 16:53933666-53933688 TTCTAATAATAGCTCATGGTAGG + Intronic
1138740825 16:59307885-59307907 TTGTATTAAAAGATCTTGGAGGG + Intergenic
1138883661 16:61048804-61048826 TTGTCTTAATTTATCTTTGTTGG + Intergenic
1139787331 16:69404428-69404450 CTCTTTTAATATATCATGCTTGG - Intronic
1140568791 16:76077145-76077167 TGCTATTGGTATATCTTTGTTGG + Intergenic
1140796610 16:78444451-78444473 TTCTCTTAATAAATGATGGTAGG - Intronic
1140925878 16:79583008-79583030 TTCTGTTAAAATATGTTGATGGG + Intergenic
1142816564 17:2430712-2430734 TTCTAAAAATATATCTAGGCTGG - Intronic
1143797849 17:9352412-9352434 TTTTTTTAATATATCTTAGCTGG + Intronic
1145113736 17:20188859-20188881 TTCTATTAATATCACTTTGGGGG - Intronic
1149727273 17:58909148-58909170 TTCTTTTAATATTTCTTGCAAGG + Intronic
1153204834 18:2687537-2687559 TTCTTTTTATGTATCTTGTTTGG + Intronic
1153886243 18:9469650-9469672 TTCCTTTAATATTTCTTGGAGGG + Intergenic
1155937920 18:31773571-31773593 AACTATTAATACATCTTTGTGGG - Intergenic
1157543591 18:48531390-48531412 TTCTATTTTTATATATTAGTAGG + Intergenic
1157638123 18:49182922-49182944 CTCTGTTACTCTATCTTGGTTGG + Intronic
1158016921 18:52793971-52793993 TTCTATTAATCTATATTTCTGGG + Intronic
1160282533 18:77505416-77505438 TTCTATTATTATAAATTGGAAGG - Intergenic
1162883393 19:13677577-13677599 TTCTTTTTATTTATCCTGGTTGG - Intergenic
1167823892 19:51954062-51954084 TTCTACAATTATGTCTTGGTTGG + Intergenic
1168446288 19:56417676-56417698 ATTTATTAATTTGTCTTGGTTGG + Intronic
925749987 2:7079444-7079466 TACTACTAATATAACATGGTAGG + Intergenic
926960209 2:18349729-18349751 CTCTGTTAATATATCTTTATTGG - Intronic
929472335 2:42207288-42207310 TTATATTAATATATATTTGGAGG - Intronic
929918127 2:46153326-46153348 TTCTATAAATATTTATTGGCAGG + Intronic
931251140 2:60531490-60531512 TTTTATTAATATTTTTTGGAGGG - Intronic
932180940 2:69644991-69645013 TAATATTAATAAATCATGGTAGG - Intronic
932473134 2:71977447-71977469 ATCTACAAAAATATCTTGGTGGG + Intergenic
932859193 2:75271321-75271343 TTCTAATAATTTTTTTTGGTGGG + Intergenic
932897010 2:75650035-75650057 TTGTATTACTATTTTTTGGTAGG + Intronic
933099224 2:78230441-78230463 TTCTGATAACATATCTTGATTGG - Intergenic
933503081 2:83141120-83141142 TTCCATTAGTATATCTTATTTGG - Intergenic
934928698 2:98401891-98401913 TTCTCTTAATTTCTCTTGGCTGG - Intergenic
935366840 2:102302379-102302401 TCCTATTACTCTATCTTGGCTGG + Intergenic
936397817 2:112142355-112142377 TTGTAATGATATATTTTGGTAGG + Intronic
937063307 2:118996572-118996594 CTCTATTAATAAATTTTGCTGGG - Intergenic
937382644 2:121394583-121394605 TTTTATTAAAAAATCTTGGCTGG + Intronic
938367462 2:130745965-130745987 TGCTGGTAATATAACTTGGTGGG - Intergenic
938679557 2:133675652-133675674 TTCTCTTTATTTTTCTTGGTTGG + Intergenic
940122768 2:150285639-150285661 TTCTAATAAAATATCTTCATTGG + Intergenic
941063250 2:160871860-160871882 TTCTACAAATACATATTGGTTGG + Intergenic
942724285 2:178989705-178989727 TGCCATTTATATATCTTTGTTGG - Intronic
943356997 2:186868587-186868609 TTCTATTAAAATAACTTGTTTGG - Intergenic
943574993 2:189620933-189620955 ATTTATTAAAATGTCTTGGTTGG + Intergenic
944354422 2:198768951-198768973 TTCTGCTAACATATCTTAGTAGG - Intergenic
944571315 2:201047602-201047624 TTCTTTTAATATGTCCTGCTTGG - Intronic
945913161 2:215672585-215672607 TTCTATGAGTTTATCTTGTTTGG - Intergenic
1169530385 20:6478740-6478762 TTCTTTTAATATTTTGTGGTAGG - Intergenic
1170229812 20:14033508-14033530 TTCTATTAAAACATCCTGTTGGG + Intronic
1170879826 20:20287030-20287052 TTCTATATATTTATCTGGGTAGG + Intronic
1171560345 20:26119048-26119070 ATTACTTAATATATCTTGGTAGG + Intergenic
1171841383 20:30216347-30216369 TTCTATTAATATTATTTAGTTGG - Intergenic
1172090926 20:32432058-32432080 TTCTATTAATTTAATTTTGTGGG + Intronic
1172328181 20:34053777-34053799 TTCCATTAAGATAGCTTGGTGGG + Intronic
1173281160 20:41629317-41629339 TTTTTTTAATATATGTTTGTTGG + Intergenic
1174960295 20:55148717-55148739 TTCTCTAAATATATTTAGGTTGG + Intergenic
1177251821 21:18602154-18602176 TTCAATTTATATATCTTCCTTGG - Intergenic
1177506122 21:22019403-22019425 TTCTGATAATAAATATTGGTTGG + Intergenic
1180653607 22:17399999-17400021 TTTTATTTATATATCATAGTTGG + Intronic
1181780555 22:25189906-25189928 TTATAAAAATTTATCTTGGTTGG - Intronic
1183019943 22:35018958-35018980 TTCAATTAATATTTGTTGGATGG + Intergenic
1183825337 22:40382307-40382329 TTTTATTACTATCTCTTGCTGGG + Intronic
1184270554 22:43379598-43379620 TTCTTTTTATTTATCTTGCTTGG - Intergenic
1184811062 22:46832346-46832368 TTCTTTTAAAATATGTTGGCTGG + Intronic
1185196233 22:49471409-49471431 TTCTAATAATATATGTTTCTGGG + Intronic
949150992 3:766670-766692 TACTATTAATTTCTATTGGTGGG + Intergenic
949160748 3:879022-879044 TTCTATTAGCTTAACTTGGTAGG - Intergenic
949663924 3:6314748-6314770 TTCTATTAAATTATCTTTTTGGG - Intergenic
949843576 3:8348282-8348304 ATCTATTGATATATGTTGATGGG - Intergenic
950918961 3:16673871-16673893 TTCTATGAATATATTTTTATTGG - Intergenic
951163621 3:19457851-19457873 GTGTATTATTTTATCTTGGTTGG + Intronic
951220034 3:20059116-20059138 TATTATTAAAATATCTTGCTGGG + Intronic
951363690 3:21754487-21754509 TTGTATTAAAATATCATGGTTGG + Intronic
951370710 3:21843560-21843582 ATATATTAATACATTTTGGTTGG - Intronic
951938375 3:28049587-28049609 TGCCATTAATATATCTTTTTTGG - Intergenic
952469701 3:33634012-33634034 TTCTTTTTATTTATCTTGCTCGG - Intronic
952781174 3:37101059-37101081 TTCTATTAAGAAATGTTGGCTGG + Intronic
953026059 3:39145892-39145914 TTGTATTAAAATTTCATGGTGGG + Intronic
953475072 3:43198640-43198662 GTGTATAAATATATTTTGGTTGG - Intergenic
954585888 3:51736239-51736261 AGCTATTAATATATCTTCTTTGG + Intergenic
955353572 3:58211787-58211809 GTCCATTAATATACCTTGATTGG - Intronic
956382748 3:68683318-68683340 TTCTTTTTATATATGTTTGTTGG + Intergenic
956538769 3:70310274-70310296 TACTATTAAAATTGCTTGGTGGG + Intergenic
956864136 3:73352705-73352727 TTGTGTTAATATAGCTTTGTTGG - Intergenic
956961508 3:74407764-74407786 TTTTATTTATATATATTTGTGGG - Intronic
957279475 3:78131506-78131528 TTCTATTAATATATTAAGGAAGG - Intergenic
957698485 3:83677283-83677305 ATCTAATAATATAACTTGATAGG - Intergenic
957943178 3:87030976-87030998 TTATATTAATATGTTTTGGTAGG - Intergenic
958519581 3:95167409-95167431 TGCTATTAATATATGTTCTTTGG - Intergenic
959906215 3:111713737-111713759 TTATATTAATATATATTTTTAGG - Intronic
960011896 3:112842655-112842677 TAATATTAATATTTCTTGCTAGG - Intronic
960076589 3:113492747-113492769 ATTTCTTAATATATCTGGGTGGG - Intronic
960141725 3:114157713-114157735 TTTTATTTATATCACTTGGTTGG + Intronic
960385955 3:117022190-117022212 TTTAATTAATTTATTTTGGTGGG + Intronic
961060588 3:123825255-123825277 ATCTATTAAGAAATGTTGGTAGG + Intronic
961335292 3:126173084-126173106 TTCTTTTAACATATCTTGTAAGG - Intronic
962968799 3:140380008-140380030 TTATAGTAGTATCTCTTGGTGGG - Intronic
963073250 3:141322480-141322502 TACTATTAATATAACTTGATAGG - Intergenic
963865801 3:150359878-150359900 TTTTCTAAATATATCTTGTTGGG + Intergenic
965795779 3:172437290-172437312 TTTTATTACTATATTTTGTTAGG - Intergenic
966482024 3:180421043-180421065 TTCTATGAATGCATTTTGGTCGG + Intergenic
967003568 3:185361314-185361336 TTCTTTTAATGTATCCTGATTGG + Intronic
967533050 3:190571159-190571181 TTTTATTAATTTATTATGGTGGG + Intronic
969008506 4:4041352-4041374 TACTATTAATATTCCTTGCTAGG - Intergenic
969745174 4:9065024-9065046 TACTATTAATATTCCTTGCTAGG + Intergenic
970531081 4:16984991-16985013 TTCTATTTAAAAATCCTGGTGGG - Intergenic
970610175 4:17717870-17717892 TTCAATTAATCTATTTAGGTTGG + Intronic
970989455 4:22195492-22195514 TTAAAATAATATATCTTGTTTGG + Intergenic
971064832 4:23019486-23019508 TTCTATGAAAAAATCTTGTTGGG + Intergenic
971225197 4:24745540-24745562 TACTATTATTATACCATGGTGGG - Intergenic
971656713 4:29355967-29355989 TTATATTAATATATCTTCGTTGG + Intergenic
971874762 4:32292693-32292715 TACTCTTGATATATCTTGCTCGG + Intergenic
972026684 4:34388031-34388053 TTCAATTAATACACCTTTGTGGG - Intergenic
972274349 4:37543181-37543203 TTCTATTACTATTTCTTTGGTGG + Intronic
973157051 4:46968696-46968718 TTTTCTTAAAATATCTTGTTTGG + Intronic
973217554 4:47687099-47687121 TTCTACTATTATAACTTGCTTGG + Intronic
973948677 4:55987975-55987997 TTCTTTTTATTTATCTTGCTTGG - Intronic
973988592 4:56380314-56380336 TTCTTTGAATATATCTTTTTAGG + Intronic
974238960 4:59218902-59218924 TTTTATTATTATAACTGGGTAGG - Intergenic
974677557 4:65113282-65113304 TTCTTTTAATATTTCTTGCAAGG - Intergenic
974999148 4:69198641-69198663 TAATATTAATATTTCTTGCTAGG - Intronic
975074831 4:70192873-70192895 TTCTAATGATATATCAAGGTAGG - Intergenic
975125991 4:70782614-70782636 CTCTAAAAATATTTCTTGGTCGG + Intronic
975478698 4:74853853-74853875 TGCTTTTAATAAATATTGGTTGG - Intergenic
975894458 4:79071329-79071351 TTCTTTTAAGACATCTTGCTTGG + Intergenic
975960847 4:79902835-79902857 TTCTATTAATATGGTTAGGTTGG - Intronic
976526210 4:86092207-86092229 TTATTTTAATATATCTTTATGGG + Intronic
976540863 4:86273721-86273743 TTCTATTAAAATAACTTAGGGGG + Intronic
976952719 4:90852363-90852385 TTATGTCAATATATCTTGGAAGG + Intronic
976995621 4:91430110-91430132 TCCTCTTAAAATATCTTGGTTGG + Intronic
977282292 4:95056225-95056247 CTATATTAATATATATTTGTTGG + Intronic
978258407 4:106720067-106720089 TTCATTTTATATATCTTGTTAGG + Intergenic
978526201 4:109669183-109669205 TTCTTTTAATATTTCTTGCAAGG + Intronic
979555073 4:122036365-122036387 TTCTAATTATATATATTTGTGGG + Intergenic
979926762 4:126577273-126577295 TAATATTAATATATCAAGGTTGG - Intergenic
980603007 4:135050184-135050206 TTCACTTAATATATCTGGTTTGG + Intergenic
980954495 4:139414707-139414729 TAATATTAATATACCTTGCTAGG - Intronic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
981159721 4:141483607-141483629 TTATTTCAGTATATCTTGGTAGG + Intergenic
981624456 4:146739924-146739946 TTCTATTCATATTTCTTTGGAGG - Intronic
981732940 4:147919244-147919266 GGATATTAATATATTTTGGTAGG + Intronic
982409028 4:155052580-155052602 TCCTATTAATATTTCTTCTTGGG - Intergenic
982960408 4:161828144-161828166 TTCTATCACTATATTTTGCTTGG + Intronic
983190915 4:164752660-164752682 TGATATTAATATTTCTTGCTAGG - Intergenic
983717498 4:170802635-170802657 ATCTAATAATATAGCATGGTAGG - Intergenic
984435431 4:179704082-179704104 TTCTATTAATAAGTCTCAGTAGG + Intergenic
984512521 4:180695762-180695784 TTCTAGTCATAAATCTTAGTAGG + Intergenic
984613215 4:181865257-181865279 TTCTATTAATATATCTTTAAAGG + Intergenic
984998249 4:185457764-185457786 GTTTATTTATATATCTTGGATGG + Intronic
985362415 4:189189638-189189660 TAATATTAATATTTCTTGCTAGG + Intergenic
986086596 5:4458432-4458454 TTCTAGTCATATATCTTCTTTGG - Intergenic
987163293 5:15167628-15167650 TTATTTTAATTTATCTTGCTTGG + Intergenic
987499348 5:18687073-18687095 CTCTATTTGTTTATCTTGGTTGG + Intergenic
988020785 5:25617836-25617858 TGTTATTCATATATCATGGTTGG - Intergenic
988810091 5:34776507-34776529 CTATATTAAAATATCTTGGCTGG + Intronic
989124600 5:38039568-38039590 TTCCATTACTATGTTTTGGTGGG + Intergenic
990108774 5:52296482-52296504 TTCTTTTAATTCATCTTGGAAGG - Intergenic
992728583 5:79634754-79634776 TTATAATGATAGATCTTGGTAGG + Intronic
993024858 5:82633355-82633377 TTCTATTAGTATATGTTCTTTGG - Intergenic
993105814 5:83599442-83599464 CTCTATTATTCTATCCTGGTGGG - Intergenic
993243360 5:85419581-85419603 TTCTATCAACATAACTTAGTAGG - Intergenic
993506350 5:88713710-88713732 TTCTAATACTATAGCTGGGTTGG + Intergenic
994202323 5:96991591-96991613 GTCTATTTATATATCTTCTTTGG + Intronic
994259262 5:97637677-97637699 TTCTATTAATGTATCTTTGATGG + Intergenic
994277001 5:97851083-97851105 TTCTAATAATATATTTTTATTGG + Intergenic
994700931 5:103134358-103134380 TTCAATTAATAGTTCTTAGTGGG - Intronic
995100352 5:108293188-108293210 TACTTTAAATATTTCTTGGTAGG + Intronic
995159260 5:108957900-108957922 TTCTAATAATATATGTTTCTAGG - Intronic
996018409 5:118566539-118566561 ATCTTTCAATATATCTTGCTGGG + Intergenic
998587130 5:143438847-143438869 TTCTATTAATTTATTTTGGATGG - Intergenic
999671619 5:153963910-153963932 TTCCATTAAAATATCATGGAAGG + Intergenic
999966293 5:156813353-156813375 TTCTTTTAATGAATCTTGATAGG - Intergenic
1000374920 5:160571059-160571081 TTCTTTTTATTTATCTTGCTTGG + Intronic
1001769070 5:174279000-174279022 TTCAATTAAGAAATATTGGTTGG - Intergenic
1003118800 6:3303084-3303106 TTTTTTTAATATATGTTTGTTGG - Intronic
1003229513 6:4239344-4239366 TTTTCTTAATAAATCTTGCTAGG + Intergenic
1004259122 6:14092737-14092759 TTCTATTGATGTATTTTGGCTGG + Intergenic
1004672100 6:17807312-17807334 TAATATTAATATTTCTTGCTAGG - Intronic
1005199221 6:23324272-23324294 TTTTATTAATATATATTCCTAGG + Intergenic
1005252007 6:23957517-23957539 ATCTATTAATATGCTTTGGTCGG + Intergenic
1005306056 6:24515346-24515368 TTCTAATATTTTATCTTGATAGG + Intronic
1007908591 6:45489787-45489809 TTCCATCAATACATCTTGCTGGG - Intronic
1008811246 6:55502503-55502525 TTCTATTAATTTATTTTTCTGGG + Intronic
1009542067 6:64972835-64972857 TAGTATTAATATTTATTGGTAGG - Intronic
1009739651 6:67727662-67727684 TTCTTTTAACATTTCTTGGTAGG + Intergenic
1012047186 6:94292277-94292299 TTCTACTAATATATGTTTTTAGG - Intergenic
1012684853 6:102233488-102233510 TTTTATTATTATAACTTTGTAGG + Intergenic
1012748436 6:103124353-103124375 TTTTATAAATATCTATTGGTGGG + Intergenic
1013066763 6:106691547-106691569 TTCAAATAAAGTATCTTGGTTGG + Intergenic
1013676309 6:112466927-112466949 GTCTATTTATATATCCTGTTAGG - Intergenic
1013723178 6:113056606-113056628 TTCTATTTGTATATCTTTTTTGG + Intergenic
1014631231 6:123792676-123792698 TTCTATCAATGTATCTGTGTGGG - Intergenic
1014992613 6:128101042-128101064 TTCCATAAATATGTCCTGGTAGG + Intronic
1015022955 6:128498762-128498784 TTCTATTTATCTATCTATGTGGG - Intronic
1015710763 6:136137323-136137345 TTCTAATAAAATTTCTTGCTTGG - Intronic
1016349492 6:143152031-143152053 TTCTGTTAACATATCTTTCTTGG + Intronic
1016734671 6:147464009-147464031 GTGTATTCATATATCTTGTTTGG + Intergenic
1016784731 6:147998080-147998102 TTCTCTTAATATAGCTTTCTTGG + Intergenic
1017197582 6:151718171-151718193 TTCAATAAAAATATCTTGGTTGG + Intronic
1017740095 6:157398592-157398614 TCCCATTATTCTATCTTGGTGGG - Intronic
1018227561 6:161643952-161643974 CTGTCTTAAGATATCTTGGTGGG + Intronic
1019895320 7:3977826-3977848 TTCAATAAATATATGTTGGTTGG + Intronic
1020328974 7:6999145-6999167 TACTATTAATATTCCTTGCTAGG - Intergenic
1021161794 7:17282700-17282722 TTCTTTTAATAGTTCATGGTTGG + Intergenic
1021287360 7:18797390-18797412 TTTTATTATTATATTTTGTTAGG - Intronic
1021461285 7:20889570-20889592 TTCAATAAATATTTCTTGATTGG - Intergenic
1023603881 7:41909506-41909528 TAATATTAATATTTCTTGCTAGG + Intergenic
1024140555 7:46459128-46459150 GTCTATTTATATATCTAGTTAGG + Intergenic
1024528390 7:50369869-50369891 TTCTAATAATATACCCTAGTGGG + Intronic
1024558258 7:50622204-50622226 TTCTATTTATAAATTTTAGTGGG + Intronic
1024570196 7:50716827-50716849 TTCTATTACTATGTCTTCATAGG - Intronic
1026431466 7:70351564-70351586 TTCTATTTTTAAATTTTGGTGGG + Intronic
1027547570 7:79547891-79547913 TTCTATTAGTCTATCTTGGCTGG - Intergenic
1028105100 7:86867796-86867818 GTCTATTAATCTATCCTGGAAGG + Intergenic
1028105156 7:86868205-86868227 TTCTATTAATTTTTCCTGGAAGG + Intergenic
1028313405 7:89368260-89368282 TTCTATTAAGATTTCTTGGCCGG - Intergenic
1030006126 7:105122017-105122039 TTGTATTGGTATTTCTTGGTAGG - Intronic
1030274992 7:107710903-107710925 TACTGTTATTATATCTTGATAGG - Intronic
1030278038 7:107740903-107740925 TTCTATGAATATATTATGCTGGG + Intergenic
1030543101 7:110858109-110858131 TTGTATTAATCTTTTTTGGTAGG + Intronic
1031293617 7:119972666-119972688 TTCTATGTATTTATCTTGCTTGG - Intergenic
1031404007 7:121361544-121361566 TTCTATCAATAAATTTTGGCAGG + Intronic
1031559612 7:123222271-123222293 TTCCATTTATATATCTTCTTTGG + Intergenic
1031605916 7:123767755-123767777 TACTATTAATATATGTGTGTGGG - Intergenic
1031927349 7:127651503-127651525 TTCCATTAATGTTTGTTGGTGGG - Intergenic
1032003316 7:128280717-128280739 TAATATTAATATTTCTTGCTAGG + Intergenic
1032402246 7:131631417-131631439 TTCTATTCATTTATCTGGCTGGG + Intergenic
1033444626 7:141409557-141409579 TTTTATTAATTTATTTTAGTTGG + Intronic
1033566480 7:142583388-142583410 TCCCGTTAATCTATCTTGGTTGG - Intergenic
1033788249 7:144760088-144760110 GTCTATTAAGATATTATGGTAGG - Intronic
1033843712 7:145406023-145406045 AAATATTAATATAACTTGGTAGG + Intergenic
1034817877 7:154189215-154189237 TTCTACTAAACTATCCTGGTTGG - Intronic
1035425419 7:158768725-158768747 TACTTTTAATATATCTTTTTTGG + Intronic
1035920061 8:3667238-3667260 TTATATTAATATATATTAATAGG + Intronic
1036249790 8:7152009-7152031 TACTATTAATATTCCTTGCTAGG - Intergenic
1036367657 8:8135010-8135032 TACTATTAATATTCCTTGCTAGG + Intergenic
1036883223 8:12530651-12530673 TACTATTAATATTCCTTGCTAGG - Intergenic
1037119277 8:15263827-15263849 TTCCTTTAACATATCTTGCTAGG - Intergenic
1037312655 8:17573262-17573284 TAATATTAATATTTCTTGCTAGG - Intergenic
1038042448 8:23735960-23735982 TTCTATTTATATTTCATGATTGG - Intergenic
1038606688 8:29013632-29013654 TTTTATTAATATGCCTTGGCAGG - Intronic
1039530316 8:38255396-38255418 TTCTTTTAATATTTCTGTGTGGG + Intronic
1039816448 8:41098771-41098793 TTTCAATTATATATCTTGGTGGG + Intergenic
1041237323 8:55817266-55817288 TTCTAATACTTTATTTTGGTAGG + Intronic
1041298011 8:56380877-56380899 TTCCATTAATATTTCTTGTGAGG + Intergenic
1042198547 8:66256382-66256404 TTCTATTCATATCTTTAGGTTGG - Intergenic
1043217552 8:77612654-77612676 TTTTATTAATATATTTTAATGGG - Intergenic
1043250559 8:78067750-78067772 TTCTATTAATATGTGTTAGTTGG + Intergenic
1043361449 8:79477127-79477149 TTCTATATATATATCTTTTTTGG - Intergenic
1044038732 8:87338334-87338356 TTCTTTTAATATTTCTTGCAAGG + Intronic
1044418471 8:91963488-91963510 TTCTATTAATATATTTCTCTTGG + Intronic
1044603485 8:94028683-94028705 TTCTGTCCATAAATCTTGGTGGG + Intergenic
1044619022 8:94171158-94171180 TTCGAGCAATATAACTTGGTGGG - Intronic
1045102854 8:98862806-98862828 TTCTATTAATAAACCAAGGTAGG + Intronic
1046215056 8:111134093-111134115 TTCTATTATTATAACTTTGTAGG - Intergenic
1047119688 8:121887241-121887263 TTCTAATATTATACCTTTGTTGG + Intergenic
1051213368 9:14769610-14769632 GTCTATTAATTTATCTTCTTGGG + Intronic
1051958117 9:22723365-22723387 TTCTACTCATATTTCTTTGTTGG - Intergenic
1053286579 9:36853329-36853351 TTCTATTAATATATCTTGGTAGG - Intronic
1055201737 9:73671603-73671625 CTCCATTAATCTATCTTTGTAGG - Intergenic
1055591316 9:77817371-77817393 TTCAATAAATATTTGTTGGTTGG + Intronic
1055801872 9:80046488-80046510 TTCCAATAATATATCTTATTGGG - Intergenic
1055870001 9:80865413-80865435 TTCTTTTAATATTTCTTGCAAGG + Intergenic
1055909895 9:81337191-81337213 TTCTATTTATTTATCTTGCTTGG - Intergenic
1057325291 9:94057884-94057906 TTCTCTTATTTCATCTTGGTTGG - Intronic
1058513756 9:105748593-105748615 TTCTATTACTATTGCCTGGTTGG + Intronic
1058661075 9:107269478-107269500 TTTTATTTATCTCTCTTGGTAGG + Intergenic
1060257648 9:122046820-122046842 TTCCATTTCCATATCTTGGTTGG - Intronic
1186011237 X:5136048-5136070 ATCTATTAATCTATTTTGTTGGG - Intergenic
1186211553 X:7255463-7255485 TTTAATTAAGACATCTTGGTAGG - Intronic
1186547334 X:10464285-10464307 TTCTATTAATGCATCATGTTTGG + Intronic
1186601009 X:11037252-11037274 TTGTATTTATATATCATGGAAGG + Intergenic
1188205579 X:27353578-27353600 TTCTATTAATATATACTGCATGG + Intergenic
1188790409 X:34402782-34402804 TTCAATGACTTTATCTTGGTTGG + Intergenic
1188939759 X:36222801-36222823 TTATATTATTATATTTTTGTAGG - Intergenic
1189584670 X:42446344-42446366 TTCTATTAACATTTCTTGTAGGG - Intergenic
1189885269 X:45537409-45537431 TTCTAATAGTTTATTTTGGTAGG - Intergenic
1190806800 X:53845442-53845464 TCCTATTTAAATATCCTGGTGGG + Intergenic
1191147520 X:57183906-57183928 TAATATTAATATTTCTTGCTAGG - Intergenic
1191773691 X:64789122-64789144 TTCTTTTAATAGGTCTTGGTGGG + Intergenic
1192970836 X:76227951-76227973 TTATGTTAATATATCTTTTTTGG - Intergenic
1193980309 X:88174437-88174459 TAATATTAATATTCCTTGGTAGG + Intergenic
1194319859 X:92432013-92432035 TTTTATTCATATTTCTTGGGTGG - Intronic
1194735212 X:97504781-97504803 TTCTATTACTAAATCTTTCTGGG - Intronic
1195587355 X:106580200-106580222 TACTATTAATATATCTATGTGGG - Intergenic
1195930585 X:110071297-110071319 TTCTTTTAAAAAATCTTGGCTGG - Intronic
1196410041 X:115408879-115408901 TTCCATTGATATATCTTGCAGGG - Intergenic
1197144037 X:123150959-123150981 GGCTATTAATATATCTTCTTTGG - Intergenic
1197847963 X:130823884-130823906 TTCTACTAATATCTCTTGGAGGG - Intronic
1200627985 Y:5545146-5545168 TTTTATTCATATTTCTTGGGTGG - Intronic
1200770627 Y:7121964-7121986 TTTTATCAAGAGATCTTGGTTGG + Intergenic
1201118119 Y:10850196-10850218 TTCTATTACTTTATTTCGGTTGG + Intergenic
1201584689 Y:15547767-15547789 TTTAATTAAGACATCTTGGTAGG - Intergenic
1201954002 Y:19600488-19600510 AAGTAATAATATATCTTGGTAGG + Intergenic