ID: 1053288801

View in Genome Browser
Species Human (GRCh38)
Location 9:36866615-36866637
Sequence CTCCTGTCCTTGTGCAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 165}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053288801_1053288807 22 Left 1053288801 9:36866615-36866637 CCAGTTCTGCACAAGGACAGGAG 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1053288807 9:36866660-36866682 GCTTCGGTGAGGAACTGAGGGGG No data
1053288801_1053288809 26 Left 1053288801 9:36866615-36866637 CCAGTTCTGCACAAGGACAGGAG 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1053288809 9:36866664-36866686 CGGTGAGGAACTGAGGGGGGTGG No data
1053288801_1053288805 20 Left 1053288801 9:36866615-36866637 CCAGTTCTGCACAAGGACAGGAG 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1053288805 9:36866658-36866680 TTGCTTCGGTGAGGAACTGAGGG No data
1053288801_1053288808 23 Left 1053288801 9:36866615-36866637 CCAGTTCTGCACAAGGACAGGAG 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1053288808 9:36866661-36866683 CTTCGGTGAGGAACTGAGGGGGG No data
1053288801_1053288810 27 Left 1053288801 9:36866615-36866637 CCAGTTCTGCACAAGGACAGGAG 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1053288810 9:36866665-36866687 GGTGAGGAACTGAGGGGGGTGGG No data
1053288801_1053288804 19 Left 1053288801 9:36866615-36866637 CCAGTTCTGCACAAGGACAGGAG 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1053288804 9:36866657-36866679 ATTGCTTCGGTGAGGAACTGAGG No data
1053288801_1053288803 11 Left 1053288801 9:36866615-36866637 CCAGTTCTGCACAAGGACAGGAG 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1053288803 9:36866649-36866671 TCTTTTTTATTGCTTCGGTGAGG No data
1053288801_1053288802 6 Left 1053288801 9:36866615-36866637 CCAGTTCTGCACAAGGACAGGAG 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1053288802 9:36866644-36866666 TAGCTTCTTTTTTATTGCTTCGG No data
1053288801_1053288811 28 Left 1053288801 9:36866615-36866637 CCAGTTCTGCACAAGGACAGGAG 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1053288811 9:36866666-36866688 GTGAGGAACTGAGGGGGGTGGGG No data
1053288801_1053288806 21 Left 1053288801 9:36866615-36866637 CCAGTTCTGCACAAGGACAGGAG 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1053288806 9:36866659-36866681 TGCTTCGGTGAGGAACTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053288801 Original CRISPR CTCCTGTCCTTGTGCAGAAC TGG (reversed) Intronic
900243710 1:1628413-1628435 CCCCGGTCCTTGGGCAGGACTGG - Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900640764 1:3687171-3687193 CTGCTCTCCTCTTGCAGAACGGG - Intronic
901391880 1:8951454-8951476 GTCCTCTCCTTGTGGAGAAGGGG + Intronic
902925699 1:19694462-19694484 CTCCTGTCCTGCAGCAGCACGGG + Exonic
903379598 1:22887467-22887489 CTCCTTTCCTTCTTCAGAAAGGG + Intronic
905394768 1:37660136-37660158 CCACTGCCCTTGAGCAGAACAGG - Intergenic
905662089 1:39735478-39735500 CTGCTGTCCATGTGCAGGCCAGG + Intronic
910454751 1:87385551-87385573 CTCTTGCACTTGAGCAGAACAGG + Intergenic
911736217 1:101339143-101339165 CTCCTGTCCTTCTGCTTACCTGG + Intergenic
912733833 1:112132844-112132866 ATCCTGCCCATGAGCAGAACAGG - Intergenic
913514450 1:119591364-119591386 CTCATTTCCTGGTGAAGAACTGG - Intergenic
915281591 1:154826288-154826310 CTCGTGGCCTGGAGCAGAACAGG - Intronic
922330339 1:224569503-224569525 CTCCTGTACGTGTGCACAAAGGG - Intronic
922605798 1:226889109-226889131 CTGCCCTCCTTGTGCAGCACTGG - Intronic
922896659 1:229106052-229106074 CTCCTGTCCTTGAGCCACACTGG - Intergenic
1062767775 10:78903-78925 CTCCTGGCCTCGTGCACAACAGG - Intergenic
1064634619 10:17351166-17351188 CACCTGGCCTAGTGCAGAAGAGG + Intronic
1067319004 10:45199370-45199392 TTCCTGTCCTGGTGCAGATATGG + Intergenic
1072767434 10:98106921-98106943 CTCCTATCCTTCTGCTGAGCTGG + Intergenic
1074109966 10:110415881-110415903 CTTCTGCCCTGGTGCAGAAACGG + Intergenic
1075060124 10:119251018-119251040 CTCCTGACCTTGTGCATGAGGGG + Intronic
1075150557 10:119926070-119926092 CTCTTGTCCTTTTGTAGAAGTGG - Exonic
1075435099 10:122433193-122433215 TTCCTGTCATTGTGCAGAGTAGG + Exonic
1076434324 10:130429763-130429785 CTTCTCTCCTTGAGCTGAACAGG + Intergenic
1076853038 10:133102464-133102486 CTCCCGTCTCTGTGCAGAAGGGG + Intronic
1083085981 11:60146010-60146032 CTCCTGAGCTGTTGCAGAACAGG + Intergenic
1083300715 11:61738391-61738413 CCCCTGTCATTGTGCAGATGGGG + Intronic
1083680574 11:64349871-64349893 GTTCTGTCCATGTGCAGAATGGG - Intronic
1083898685 11:65633271-65633293 CTCCTGTACTTTTGCCCAACAGG + Intronic
1084072021 11:66743088-66743110 CTCTTGTCCTTTTTCAGAAGAGG - Intergenic
1084597363 11:70124930-70124952 TTCCAGTCCTTATGCTGAACAGG + Intronic
1085582118 11:77661550-77661572 CTCCTGCCCTTTAGCAGAATTGG - Exonic
1085773226 11:79342908-79342930 TTCCTGTCCTTGTCCAAAACTGG + Intronic
1085803020 11:79608909-79608931 CTCCTGTCTTTGTGCTCATCTGG + Intergenic
1086491657 11:87362280-87362302 CTCCTGGCAATGTGCAGAAGGGG + Intergenic
1086980842 11:93196591-93196613 CTCCTGACCTTGTGATGATCCGG + Intronic
1088754301 11:112872906-112872928 CTCCTGGCCTTGGGCACAACTGG + Intergenic
1089384467 11:118058797-118058819 GAGCTGTCCTTCTGCAGAACAGG + Intergenic
1090777551 11:129978699-129978721 CTACTTTCCTTGTGCACAAAGGG + Intronic
1095864527 12:46956955-46956977 CTGCTGTCCGGTTGCAGAACGGG + Intergenic
1096833251 12:54330972-54330994 CTCCTGTTTTTGGGCAGAATAGG + Intronic
1098468251 12:70813873-70813895 CTCCCATCCTTGTGCTGATCAGG - Intronic
1101123597 12:101608787-101608809 CTCCTGCCCTTGTTAAGAAATGG + Intronic
1101685200 12:107012349-107012371 CTACTCTGCCTGTGCAGAACAGG + Intronic
1103250993 12:119499931-119499953 CTCCTCTACTTGTGAAGAAATGG - Intronic
1103361892 12:120359463-120359485 CTCCTGGCCTTTTACAGAAAGGG - Intronic
1104591097 12:130085255-130085277 CCCATGTCTTTCTGCAGAACGGG - Intergenic
1114409877 14:22490636-22490658 CATCTGTCCTTGTTCATAACTGG + Intergenic
1119171174 14:72537403-72537425 CTCCTGCCCTTGTGTAGCCCTGG + Intronic
1121495263 14:94387933-94387955 CTCCTGTCCCAGTGGAGGACAGG - Intronic
1121582347 14:95040283-95040305 CTCCTGACCTGGAGCAGCACAGG + Intergenic
1121933582 14:97995865-97995887 GTCCTGTCCCAGTGCAGGACTGG + Intergenic
1125349963 15:38756161-38756183 CTCCGGGCCTTGGGAAGAACTGG - Intergenic
1127576740 15:60299053-60299075 CTCATTTCCTTGTGCACAAATGG - Intergenic
1128353644 15:66908994-66909016 ATCCTGGCCTTGGGCAGATCAGG + Intergenic
1128635534 15:69299750-69299772 CTCTTATCCGTGAGCAGAACCGG + Intronic
1130389985 15:83447058-83447080 CTTCTGTCTTGGTGCCGAACCGG - Intergenic
1130547180 15:84865248-84865270 CTACTGTCATTAAGCAGAACTGG + Intronic
1131396713 15:92092081-92092103 CTCCTGCCCTCTTGCAGAAAAGG - Intronic
1133263156 16:4565358-4565380 CTCCTGTCCTGGGGAAGAAGGGG - Intronic
1135118257 16:19742152-19742174 CTCCTGTCATTGGGCGGAAGAGG + Intronic
1137488782 16:48913526-48913548 CTCCTGTCCATGGGAAGCACAGG + Intergenic
1138093899 16:54197171-54197193 CTCCTGACCCTGGGCAGGACAGG + Intergenic
1139338309 16:66249316-66249338 ATCCTGTCTTTATGCAGATCAGG - Intergenic
1141575942 16:84963692-84963714 CACCTCTCCTTGGGCAGAGCGGG - Intergenic
1144032028 17:11331872-11331894 CTCCTGTTTGTGTGCAGAGCTGG - Intronic
1146727537 17:35168444-35168466 CTGCTGTCCTTGAGGAGACCAGG + Intronic
1147045511 17:37748869-37748891 CCCCTGACCTCCTGCAGAACAGG - Intergenic
1147248073 17:39135189-39135211 CTCCTGTCTTTAGGCAGAGCCGG + Intronic
1150270715 17:63862708-63862730 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1150274344 17:63886229-63886251 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1150276487 17:63901057-63901079 CTTCTGTGCTTGGGCAGGACTGG + Intergenic
1150590449 17:66557920-66557942 GTCCTCTGCCTGTGCAGAACTGG - Intronic
1152960608 18:78237-78259 CTCCTGGCCTCGTGCACAAGTGG - Intergenic
1154980694 18:21500145-21500167 CTCATGTCCTTGTTCAGGAGTGG - Exonic
1156700691 18:39820862-39820884 CTGCTGACCTTGGGCTGAACTGG + Intergenic
1157105081 18:44766581-44766603 CTCTTTTCATTGTGCAAAACTGG - Intronic
1157616867 18:48992261-48992283 CCCCTCTCCTTGTCCAGCACTGG + Intergenic
1158319094 18:56243882-56243904 CTGCTGTCTTTTTGCAGAAAAGG - Intergenic
1160051181 18:75435220-75435242 TTCCTGCCATAGTGCAGAACCGG + Intergenic
1164075746 19:21816574-21816596 CTCCAGGCCTTTTGAAGAACAGG - Intronic
1166299484 19:41905965-41905987 CTCCTGCCCTTCTGCAGACCAGG + Exonic
1167953301 19:53045027-53045049 CTCCTGCCCTAATGCAGATCTGG + Intronic
927250283 2:20990344-20990366 CTCCTGTCCCTGAGCAGTCCTGG + Intergenic
928932329 2:36637241-36637263 CTCCTTTCCTTAAGCAGAAGGGG - Intronic
929708842 2:44245567-44245589 CTCTAGTCATTGTACAGAACAGG - Intergenic
932597921 2:73105774-73105796 CACCTGGCCCTGTGCAGAGCAGG + Intronic
933023855 2:77228722-77228744 GTCCTGTCCTTGTTCATATCAGG + Intronic
937234695 2:120423586-120423608 CTCCTCTCCTTGGCCAGAGCGGG + Intergenic
938792749 2:134691245-134691267 CTGCTGGCCTTCTGCAGAAAAGG + Intronic
939271892 2:139949781-139949803 CTCATGTCCTTATAAAGAACAGG + Intergenic
945913454 2:215676862-215676884 CTGCTGTCTATTTGCAGAACAGG + Intergenic
946130206 2:217600777-217600799 CTACTGTCCTGGTGGAGAAGAGG + Intronic
946947750 2:224839332-224839354 CTCCTGTCCTTGTGATCCACCGG + Intronic
948555963 2:238811191-238811213 CTCCTGCCCTTCTGAACAACCGG - Intergenic
948939297 2:241188083-241188105 CTCCTGTCCTTTTGCAGATGGGG + Intergenic
1168899934 20:1354807-1354829 CTCCTTTCCTTAGGCAGAAGGGG + Intronic
1168948579 20:1781246-1781268 CTCTTGACCTGGTGCAGAGCAGG - Intergenic
1171413853 20:24964220-24964242 CCCCTGTCCCTGTGAAGATCAGG + Intronic
1172448184 20:35003854-35003876 CACCTGTCCCTGTCCAGACCTGG + Intronic
1175004329 20:55666246-55666268 CTCCCGTCCATGTGCACAGCTGG - Intergenic
1175961196 20:62637256-62637278 TTCCTGGCCGTGTGCAGAGCTGG - Intergenic
1177927983 21:27242737-27242759 CTCCTGTCCTTGGACAAATCTGG + Intergenic
1179207072 21:39291644-39291666 CTCCTGGCCTTGTGCACATATGG - Intronic
1179273079 21:39866459-39866481 CTCATCTCCCTGTGCAGAGCAGG - Intergenic
1179718705 21:43303348-43303370 CTCGTGTCCTTGGGCAGCTCCGG - Intergenic
1179993004 21:44958371-44958393 CTCCTGTGCTTCCGCAGCACCGG + Intronic
1180706145 22:17811080-17811102 CTCCTGTCCCTGTGCAGAGGTGG - Intronic
1180726751 22:17952162-17952184 GTCCTGTCTTTGTACAGAAAAGG - Intronic
1182094818 22:27619013-27619035 CTCCTGTCTCTGTGCATAATAGG - Intergenic
1183253372 22:36745512-36745534 CTCCCTTCCTTGTGCAGGGCAGG - Intergenic
1185404807 22:50641730-50641752 CTGCTGACCTTGTGGAGAGCAGG + Intergenic
950266280 3:11575506-11575528 CTCCTTTCCTTGGGCACAATCGG + Intronic
950650834 3:14405588-14405610 CTCATGACCTTCTGCAGAAGTGG - Intronic
952006372 3:28846858-28846880 TTCCTGTCCTGGTTCAGAACTGG + Intergenic
952738697 3:36715278-36715300 TCTCTGTCCTTGAGCAGAACTGG + Exonic
952793153 3:37216450-37216472 CTGCTGGCCTTGTCCAGAACTGG + Intergenic
956891053 3:73614447-73614469 CACCTGTCCTTAGGCAGAAAAGG - Intronic
957211483 3:77264436-77264458 CTCCTGTGCTTGTGCACATTTGG + Intronic
960943485 3:122949956-122949978 CTCCTGTCCTTCTGCTTAGCTGG + Intronic
961474359 3:127137442-127137464 CTCCTCTGCTTCTGCAGGACGGG + Intergenic
961831023 3:129623113-129623135 CTCCTGTCCTTGCCCAGTGCTGG + Intergenic
962322403 3:134402731-134402753 CTCCTGCCCTTGTGGGCAACAGG + Intergenic
967016971 3:185491221-185491243 CTCCTGACCTTGTGAATCACCGG + Exonic
967582543 3:191177189-191177211 CTCATAGCCTTCTGCAGAACTGG - Intergenic
968789880 4:2652222-2652244 TTCCTGTCCTGGTGTTGAACAGG + Intronic
968858914 4:3150807-3150829 CTCCTGACCTTGTGATGCACTGG - Intronic
969903975 4:10375888-10375910 CTCCTGGCCCTGTGAAGTACAGG - Intergenic
970362629 4:15325145-15325167 CTTCTGTCCATGTCCAGAACTGG + Intergenic
972889891 4:43544139-43544161 CTCATGTCCAGTTGCAGAACTGG - Intergenic
974221070 4:58971929-58971951 TTCCTGTCCTTGTGATGAATTGG + Intergenic
978282594 4:107035797-107035819 TTCCTGTCCTGGTGGAGAAGCGG - Exonic
979969638 4:127118144-127118166 GTCCAGTCCTTGTTCAGAAAAGG + Intergenic
981324648 4:143431972-143431994 CTCCTGACCTGGTGGAGAATAGG + Intronic
985351328 4:189065586-189065608 CTCATGTTGTTGTACAGAACAGG + Intergenic
985909096 5:2864964-2864986 CTCCTCTCCCTGTGAAAAACTGG - Intergenic
988526072 5:31988417-31988439 CTTCTGTCCTTGTGGAGATGGGG + Intronic
989732082 5:44661320-44661342 CTCCTCTTCTTTTCCAGAACAGG - Intergenic
990308518 5:54517277-54517299 CTCCTCTCCTTGAGCAGAAGAGG + Intergenic
990601614 5:57364602-57364624 CTCCTGGCCATGTGCACAAGGGG - Intergenic
992089847 5:73307198-73307220 CTCCTGTCCTGCTGCAGAGCTGG - Intergenic
995251383 5:109997003-109997025 ATCCTTTCCTTGTGCAGGAAGGG - Intergenic
997232491 5:132254811-132254833 CTCCTGACCTTGGACAGACCTGG + Intronic
997353834 5:133249571-133249593 CTCCTTTCCCTCTGCAGAAGTGG - Exonic
1001416711 5:171549933-171549955 CCCCTGTCCAGCTGCAGAACAGG - Intergenic
1002441297 5:179265759-179265781 CTCCTGTCCTCGTGCAGACCGGG - Intronic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1007635961 6:43299881-43299903 CTCCTGTCCTGGCCCAGAGCTGG + Exonic
1009056321 6:58340678-58340700 CTCCTCACATTGTGCAGAATTGG + Intergenic
1009234861 6:61109921-61109943 CTCCTCACATTGTGCAGAATTGG - Intergenic
1013176394 6:107680990-107681012 CTGCTAACCTTGTGCAGAAATGG - Intergenic
1013995915 6:116307759-116307781 CTTCTTTCCTTGTGCAGCATGGG - Intronic
1016505383 6:144773200-144773222 TTCCTGCCCTTTTGCAGATCTGG - Intronic
1019550207 7:1598464-1598486 CTGCTGGCCTTCTGCAGGACTGG + Intergenic
1019837970 7:3409563-3409585 ATCCAGTCCTTTTGCAGGACAGG + Intronic
1020026282 7:4902337-4902359 CTCCTGCCCTTGGCCAGACCTGG - Intergenic
1021346863 7:19539595-19539617 CTCCTGTCTTAGTTCAGAATGGG - Intergenic
1023587467 7:41745484-41745506 CTCCTGTCCTTTTGCTTAGCTGG - Intergenic
1023851839 7:44154654-44154676 CACCTGTCATTGGCCAGAACTGG - Intronic
1023912650 7:44566653-44566675 CTCCTGGCCCTGTGCAGATGTGG - Intronic
1025191660 7:56900174-56900196 CTCCTGTCCTTCTGCACACCAGG + Intergenic
1025680288 7:63676760-63676782 CTCCTGTCCTTCTGCACACCAGG - Intergenic
1026906552 7:74066086-74066108 CTCCTGTCCTTGTGTGGACATGG - Intronic
1026967285 7:74448215-74448237 CTCCTGGCCCGGTGCAGAACTGG - Intergenic
1035655243 8:1300519-1300541 CTCCTGTCCCTGTTCAGTCCCGG + Intergenic
1035917523 8:3641291-3641313 CTCCTGTGCAGGTGGAGAACGGG + Intronic
1038392204 8:27212572-27212594 CCTGTGTCCATGTGCAGAACGGG - Intergenic
1040837747 8:51750247-51750269 ATCCTGACCTTGTGCAGGCCTGG - Intronic
1046799964 8:118415196-118415218 CTCCTGTCCTTCAGAAGAAAAGG + Intronic
1048871719 8:138804429-138804451 CTGCTGTGCTTGAGCAGAGCAGG - Intronic
1049011931 8:139892985-139893007 CTCCTGACCACCTGCAGAACGGG - Intronic
1053288801 9:36866615-36866637 CTCCTGTCCTTGTGCAGAACTGG - Intronic
1053482792 9:38428389-38428411 GCCCTGTACTTGTGCAGTACAGG - Intergenic
1056858597 9:90158538-90158560 GTCCTGTGCTTTTGTAGAACTGG - Intergenic
1061820773 9:133226203-133226225 CTGCTGTCCTTCTGCAGACAGGG - Intergenic
1062027966 9:134349283-134349305 CGGCTGTCCAGGTGCAGAACAGG - Intronic
1062447258 9:136600148-136600170 CTCCCGTCCATGTGCAGAGCAGG + Intergenic
1062737486 9:138145468-138145490 CTCCTGGCCTCGTGCACAAGTGG + Intergenic
1186526696 X:10255498-10255520 CTTCTCTCCTTTTGGAGAACTGG + Intergenic
1189230077 X:39445292-39445314 CTCCTGTCCTTGTCTAGACCTGG + Intergenic
1195485791 X:105404535-105404557 CTCCTGTCCCTGAACAGAATAGG - Intronic
1196053831 X:111333869-111333891 CTCATCTCTTTGTGCAGAAAGGG - Intronic
1199929802 X:152506689-152506711 CTCCTGAGGTTGTACAGAACAGG + Intergenic