ID: 1053289094

View in Genome Browser
Species Human (GRCh38)
Location 9:36868336-36868358
Sequence AGGCAGGGCCAGGATCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053289084_1053289094 21 Left 1053289084 9:36868292-36868314 CCACCCACAGCTACTGAGCACCT 0: 1
1: 0
2: 2
3: 36
4: 405
Right 1053289094 9:36868336-36868358 AGGCAGGGCCAGGATCTGAGAGG No data
1053289085_1053289094 18 Left 1053289085 9:36868295-36868317 CCCACAGCTACTGAGCACCTACT 0: 1
1: 3
2: 19
3: 105
4: 541
Right 1053289094 9:36868336-36868358 AGGCAGGGCCAGGATCTGAGAGG No data
1053289088_1053289094 1 Left 1053289088 9:36868312-36868334 CCTACTGCAGGCAGCACCTACTG 0: 1
1: 0
2: 1
3: 22
4: 354
Right 1053289094 9:36868336-36868358 AGGCAGGGCCAGGATCTGAGAGG No data
1053289083_1053289094 22 Left 1053289083 9:36868291-36868313 CCCACCCACAGCTACTGAGCACC 0: 1
1: 1
2: 3
3: 26
4: 253
Right 1053289094 9:36868336-36868358 AGGCAGGGCCAGGATCTGAGAGG No data
1053289086_1053289094 17 Left 1053289086 9:36868296-36868318 CCACAGCTACTGAGCACCTACTG 0: 1
1: 0
2: 5
3: 38
4: 291
Right 1053289094 9:36868336-36868358 AGGCAGGGCCAGGATCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053289094 Original CRISPR AGGCAGGGCCAGGATCTGAG AGG Intronic
No off target data available for this crispr