ID: 1053289872

View in Genome Browser
Species Human (GRCh38)
Location 9:36872860-36872882
Sequence CCTCATGCCCAGAGGTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053289864_1053289872 19 Left 1053289864 9:36872818-36872840 CCTGGGCAGAGCCTGCCCTCTGC 0: 1
1: 0
2: 7
3: 70
4: 527
Right 1053289872 9:36872860-36872882 CCTCATGCCCAGAGGTTTCCAGG No data
1053289866_1053289872 8 Left 1053289866 9:36872829-36872851 CCTGCCCTCTGCAAGGCTATTGG 0: 1
1: 0
2: 0
3: 7
4: 181
Right 1053289872 9:36872860-36872882 CCTCATGCCCAGAGGTTTCCAGG No data
1053289869_1053289872 3 Left 1053289869 9:36872834-36872856 CCTCTGCAAGGCTATTGGATGCT 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1053289872 9:36872860-36872882 CCTCATGCCCAGAGGTTTCCAGG No data
1053289863_1053289872 28 Left 1053289863 9:36872809-36872831 CCACATCTGCCTGGGCAGAGCCT 0: 1
1: 0
2: 2
3: 46
4: 348
Right 1053289872 9:36872860-36872882 CCTCATGCCCAGAGGTTTCCAGG No data
1053289868_1053289872 4 Left 1053289868 9:36872833-36872855 CCCTCTGCAAGGCTATTGGATGC 0: 1
1: 0
2: 1
3: 7
4: 82
Right 1053289872 9:36872860-36872882 CCTCATGCCCAGAGGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053289872 Original CRISPR CCTCATGCCCAGAGGTTTCC AGG Intronic
No off target data available for this crispr