ID: 1053290030

View in Genome Browser
Species Human (GRCh38)
Location 9:36873704-36873726
Sequence TTTGAGCATCAGATGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053290030_1053290037 11 Left 1053290030 9:36873704-36873726 CCTCTCTCCATCTGATGCTCAAA 0: 1
1: 0
2: 1
3: 11
4: 246
Right 1053290037 9:36873738-36873760 AAGTTCTCACCAGTGTCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053290030 Original CRISPR TTTGAGCATCAGATGGAGAG AGG (reversed) Intronic
900381059 1:2384201-2384223 TCTGAGCATTGGATGGACAGTGG - Intronic
900708899 1:4098439-4098461 TTTCAGCATGAGATTTAGAGGGG + Intergenic
901226407 1:7615317-7615339 TTTTAGCATCAGTTGGAGGGAGG - Intronic
902939204 1:19787601-19787623 ATGGAGCATCAGATGGGGAAGGG + Intronic
903188652 1:21643927-21643949 TTTGAGCATCACCAGGAGATAGG + Intronic
905133924 1:35783332-35783354 TTGGAGTCCCAGATGGAGAGGGG - Intergenic
905869753 1:41396391-41396413 TTTCCGCAGCAGATGGAGCGAGG + Intergenic
907730773 1:57063116-57063138 TAGGAGCATCAGATGGGGACAGG + Intronic
909138005 1:71826114-71826136 TGAGAACATCAGATGGAAAGAGG - Intronic
909364217 1:74800500-74800522 TTTCAGCATGAGATGTGGAGAGG + Intergenic
909723014 1:78798066-78798088 TTACAGTATAAGATGGAGAGTGG - Intergenic
910271288 1:85397789-85397811 TTTCAGCATGAGATTTAGAGGGG - Intronic
910912161 1:92247567-92247589 CTTGAGAGTGAGATGGAGAGTGG + Intronic
911036487 1:93555359-93555381 TTAAAGCTTCAGATGGACAGAGG + Intergenic
911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG + Intronic
911569620 1:99507599-99507621 CTTCAGCAACAGAGGGAGAGGGG - Intergenic
911585878 1:99689814-99689836 TCTGAGCATCAAATGGGGAATGG - Exonic
913240886 1:116828238-116828260 TTTCAGCATGAGATGTGGAGGGG + Intergenic
913602457 1:120434728-120434750 TTTCAACATATGATGGAGAGTGG - Intergenic
914190602 1:145407045-145407067 TTTCAACATATGATGGAGAGTGG + Intergenic
914588409 1:149083919-149083941 TTTCAACATATGATGGAGAGTGG + Intronic
915193233 1:154169434-154169456 TTTCAGAAGCAGATGAAGAGAGG + Intronic
916497326 1:165357034-165357056 TTATAGCAGCAGTTGGAGAGCGG - Intergenic
916739279 1:167634123-167634145 TTTGAGCTACAGACCGAGAGGGG - Intronic
917750273 1:178046883-178046905 TTTGAGGGTAAGATGGAGAGGGG + Intergenic
918992536 1:191716500-191716522 TTTGATCAACAAATGGATAGCGG - Intergenic
920354752 1:205363149-205363171 CTTGAGCATCAGATAGATATGGG + Intergenic
920526148 1:206668042-206668064 TTTGGCAACCAGATGGAGAGTGG + Intronic
920792530 1:209106651-209106673 GTACAGCACCAGATGGAGAGAGG - Intergenic
921487588 1:215733376-215733398 TTTTAGCATGAGATTTAGAGAGG + Intronic
923406280 1:233664423-233664445 TTTGGGCATCATATTGAAAGAGG - Intronic
924509184 1:244714351-244714373 TTTGATTAGAAGATGGAGAGAGG - Intergenic
924602286 1:245502197-245502219 TTTGAGAATGAGTTGGAGTGAGG + Intronic
1063139322 10:3242754-3242776 GTTGTGTATGAGATGGAGAGAGG + Intergenic
1065964834 10:30762707-30762729 TTTGAGCCCCAGAAGGAGACTGG + Intergenic
1069666197 10:70161659-70161681 TTTGAGCATGTGAAGAAGAGTGG + Exonic
1069683545 10:70301586-70301608 TCTGAGCACCTGATGGTGAGGGG + Intronic
1070147801 10:73787279-73787301 ATTCAGCTTCAGTTGGAGAGAGG + Intronic
1071019477 10:81035321-81035343 TTTGAACTTCAGATGGAGGGAGG + Intergenic
1071400908 10:85269716-85269738 TTTGAACATGAGATTTAGAGGGG + Intergenic
1072742028 10:97915269-97915291 TTTAAGCATCAGGAGGAGATGGG + Intronic
1074254134 10:111783425-111783447 AGTGAGAATCACATGGAGAGAGG + Intergenic
1075986882 10:126796040-126796062 TTTAAGAATCAGGTGGAGTGGGG + Intergenic
1076897373 10:133319228-133319250 TATGAGCATGAGAGGCAGAGAGG - Intronic
1077499964 11:2904884-2904906 TTTGAGCAGCAGGTGGGGTGTGG - Intronic
1078963060 11:16302168-16302190 TTTGACTATCAGTTGGAAAGAGG - Intronic
1079090999 11:17480237-17480259 TTTGAGCACCTGAAGGAGACAGG - Intergenic
1080702609 11:34657138-34657160 TTTGAGAAACAGCTGCAGAGGGG - Intronic
1080953442 11:37064381-37064403 TTTTAGCATGAGATTTAGAGGGG - Intergenic
1081811395 11:45916099-45916121 TTTGAGGCTCAGATGGACATAGG + Intronic
1081868452 11:46372356-46372378 TGGGAGCAGCAGAGGGAGAGGGG - Intronic
1083102707 11:60326627-60326649 TATGAGCATAGGATGGAGGGTGG + Intergenic
1083224448 11:61276064-61276086 TTTGAGTATGCGATGGAGTGGGG - Intronic
1084656876 11:70524850-70524872 TGTGTGCATGAGATGGTGAGAGG - Intronic
1084719074 11:70892583-70892605 CTTCAGCATCAGATGGACATGGG + Intronic
1084843523 11:71879043-71879065 TTTGATCAAAAGATGGTGAGAGG + Intronic
1085347761 11:75779244-75779266 TTTGAGCATGATATGGGCAGAGG + Intronic
1086388633 11:86337419-86337441 TCTGAGCAACAGATGGAGTTCGG - Exonic
1087261782 11:96020255-96020277 AATGAGAATCTGATGGAGAGGGG - Intronic
1087813988 11:102638453-102638475 TTGGAGCATCACATGTAGATGGG + Intergenic
1088084300 11:105959227-105959249 TTTGAGTACCAGAAGGAGATAGG - Intronic
1091690125 12:2590204-2590226 GATGAGCATCAGATGGAGGGGGG + Intronic
1091833417 12:3567117-3567139 GTTGATCCACAGATGGAGAGGGG - Intronic
1091850828 12:3695458-3695480 TTTGTGCAACAGTTAGAGAGTGG + Intronic
1092465684 12:8729522-8729544 TGTGGGCACAAGATGGAGAGTGG + Intronic
1094152001 12:27295008-27295030 TTTCAGGATCAGATGCAGAAAGG - Intronic
1098938202 12:76504513-76504535 TTTCACCATCAGAAGAAGAGTGG - Intronic
1100001370 12:89840374-89840396 TTTCAGCAGCAGGTGGTGAGAGG - Intergenic
1101645255 12:106625578-106625600 TTGGAGCATCATATACAGAGAGG + Intronic
1102577366 12:113864354-113864376 CTTGAGCATCTGAGGAAGAGGGG - Intronic
1104424079 12:128660285-128660307 TTTGAGCACCAGAATCAGAGAGG - Intronic
1104447126 12:128843657-128843679 TTTCAGCATCAGTTTTAGAGAGG + Intergenic
1104541043 12:129664973-129664995 GTTGAGGATCAGGTGTAGAGAGG + Intronic
1104835461 12:131787120-131787142 TTGGAGCAGGAGATGGAGGGAGG + Intronic
1106100456 13:26690892-26690914 ATTGATGAACAGATGGAGAGGGG - Intergenic
1106593544 13:31118204-31118226 TGAGAGCATGAGGTGGAGAGGGG + Intergenic
1107435450 13:40377050-40377072 TTGGAGCATAAGCTGGACAGAGG - Intergenic
1107943467 13:45395841-45395863 TGTGAGCAACAGATGAAGACTGG - Exonic
1109513175 13:63405550-63405572 TTTCAGCATGAGATTTAGAGAGG + Intergenic
1111897063 13:94155096-94155118 TTTGACCTGCAGATGCAGAGTGG - Intronic
1113565872 13:111319514-111319536 TGTGGGCATCAGGTGGACAGAGG - Intronic
1113679727 13:112234809-112234831 TTTCAACATGAGATTGAGAGGGG - Intergenic
1114547671 14:23514269-23514291 GTGGAGCAACAGACGGAGAGTGG + Intergenic
1115836163 14:37406638-37406660 TTAAAGCATCAGATGGAATGTGG - Intronic
1116712583 14:48387325-48387347 TTTGAGCATAAGAAACAGAGGGG - Intergenic
1117836685 14:59815401-59815423 TTTAAGCATGAGAGGGAAAGGGG - Intronic
1122075655 14:99233063-99233085 TTTCAGCCTCAGATGCTGAGGGG + Intronic
1124499479 15:30214205-30214227 TTTGGGCAACAGATGGTCAGGGG + Intergenic
1124744100 15:32324457-32324479 TTTGGGCAACAGATGGTCAGGGG - Intergenic
1126315097 15:47361672-47361694 TTTGAGGAACAGATGATGAGAGG + Intronic
1129155029 15:73712414-73712436 ATTCAGCTTCAGATGCAGAGTGG + Intronic
1130305236 15:82709085-82709107 TGTGAGGGTCAGATGGAGATGGG + Intronic
1134189351 16:12109269-12109291 ATAGAGCAGCAGATGGGGAGGGG + Intronic
1134879024 16:17728125-17728147 TTTGAGCTGGAGGTGGAGAGAGG - Intergenic
1136075597 16:27815162-27815184 TTTCAGCATAAGATTTAGAGGGG - Intronic
1136226868 16:28865681-28865703 TTGGAGGATCCGATGTAGAGGGG + Intronic
1137570479 16:49563129-49563151 TTTGAACATGAGATTTAGAGAGG - Intronic
1139346506 16:66307192-66307214 CTTGAGCATCAGAAACAGAGTGG + Intergenic
1139500534 16:67360712-67360734 TTAGAGCCTCAGATGGATGGAGG + Intronic
1143300833 17:5909681-5909703 TTAGAGCATCGGAGGCAGAGGGG + Intronic
1143742191 17:8962883-8962905 TTTGAGCCTCAGATATAGATGGG - Intronic
1143819734 17:9550683-9550705 TTTGAACCACAGATGGAGCGGGG + Intronic
1144713633 17:17419640-17419662 TTTGGGGATCAGAGGCAGAGAGG - Intergenic
1146569917 17:33943461-33943483 TTTGAGGATGAAATGGAGGGAGG - Intronic
1147554633 17:41468957-41468979 TTATAGCATCAGATGGAAGGAGG + Intergenic
1149318671 17:55462834-55462856 TATGAGCCTCAGATGTGGAGAGG + Intergenic
1149863616 17:60138445-60138467 TTTGAGCAGCTGCTGGAAAGCGG + Intergenic
1151245182 17:72788980-72789002 TTTGAGCATCAGATTCTTAGAGG + Intronic
1152713462 17:81886631-81886653 TTTGAGAATGAGATGGGAAGGGG - Intergenic
1153009511 18:525311-525333 TCTGAGCATGAGAAGGAAAGGGG - Intergenic
1153298068 18:3566878-3566900 AATGAGAATCTGATGGAGAGAGG - Intronic
1155836089 18:30585834-30585856 ATTCAGCATCAGATTTAGAGGGG + Intergenic
1157553466 18:48597382-48597404 TTTCAACATGAGATTGAGAGGGG - Intronic
1161793209 19:6373085-6373107 GTGGAGCATCAGATGGGGCGGGG + Intronic
1162466141 19:10842027-10842049 TCTGAGCAACAGATGGAGTTCGG - Intronic
1164140840 19:22461215-22461237 TTTGAGCATCAGCTCTAGAGAGG - Intronic
1164662310 19:29986578-29986600 TTTGAGAATGAGCTGGAGAATGG + Intronic
1164858587 19:31544549-31544571 TTTCAGCATGAGATGAAGAGGGG + Intergenic
1166853739 19:45772176-45772198 TTTGAGCAGCAGAGGGACATAGG - Intronic
1167398728 19:49250116-49250138 TTGGAGTTTCAGAGGGAGAGGGG - Intergenic
927043422 2:19253218-19253240 TTTGAGAATCAGCTGCACAGAGG - Intergenic
928524998 2:32130785-32130807 TTTGAGCCTCTCATGGAAAGAGG - Intronic
930755789 2:54970737-54970759 TTTTAGCACCATATGGAGAAAGG - Exonic
934865574 2:97807260-97807282 TTTCAGCATGAGATTTAGAGGGG - Intronic
935331136 2:101978859-101978881 CCTGAGAATCAGATGGAAAGTGG - Intergenic
936583285 2:113726598-113726620 CTTTAGCATCAGACAGAGAGTGG - Intronic
936635527 2:114252243-114252265 TTTCAGCATGAGATTTAGAGGGG - Intergenic
939391289 2:141571955-141571977 TTTGAGTACCAGAAGGAGATAGG + Intronic
939400544 2:141686881-141686903 TTAGAGCATCACATGGCTAGGGG - Intronic
940084345 2:149841226-149841248 ATTGAGCACCAAATTGAGAGTGG - Intergenic
941564482 2:167089170-167089192 TTCCAGCATCACATGTAGAGAGG + Intronic
944763242 2:202839056-202839078 TTTCAACATCAGATTGGGAGGGG + Intronic
945371625 2:209025631-209025653 AGTGAGCAACAGATGCAGAGAGG + Intergenic
945911663 2:215656844-215656866 TTTGAGGAGCAGAAAGAGAGGGG - Intergenic
946046577 2:216826378-216826400 AGTGAGGAACAGATGGAGAGCGG - Intergenic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
1169163812 20:3406467-3406489 TTTGAGAAGGAGAGGGAGAGGGG - Intronic
1170113377 20:12829788-12829810 TGTGAGCATCAGGAGGTGAGTGG + Intergenic
1170481759 20:16773011-16773033 TTTTAACATGAGATGTAGAGGGG - Intergenic
1171030736 20:21674340-21674362 TTTGAGAACCACATGGACAGGGG + Intergenic
1171992329 20:31706084-31706106 TCTGAGTAGCAGATGGAGAGTGG + Intronic
1174444129 20:50579067-50579089 TTTCAGCATGAGATTGGGAGGGG + Intronic
1175120820 20:56715085-56715107 CTTGAGCATCAGTGAGAGAGGGG + Intergenic
1175637824 20:60600266-60600288 TTTCAGCGTGAGATGTAGAGGGG + Intergenic
1177285430 21:19042460-19042482 TTTCAGTAGCAGATGGGGAGAGG - Intergenic
1178522040 21:33294600-33294622 TTTGAGCAGCTGATGGAGGGTGG - Intronic
1180631715 22:17234454-17234476 TTTCATCATCACAAGGAGAGGGG - Intergenic
1181661594 22:24354216-24354238 TTTGAGCATGAGATTTGGAGGGG + Intronic
1182975768 22:34622606-34622628 TTTGAGCATGGCATGGAGAATGG + Intergenic
1183512177 22:38242747-38242769 TTTTAGCATCAGAGGCAGCGGGG - Intronic
949595377 3:5538764-5538786 ATTCAACATGAGATGGAGAGGGG + Intergenic
949716596 3:6938990-6939012 TTTAAGCAAGAGATCGAGAGGGG - Intronic
954634677 3:52065039-52065061 TTTGAGCAGGGGATGGGGAGGGG + Intergenic
957291507 3:78282833-78282855 TTGGAGTATCAGAAGGAGACAGG + Intergenic
959677266 3:109050409-109050431 CTTGAACATCACATGGAGAAGGG + Intronic
962044211 3:131738507-131738529 TTTAAGCAACAGATGGGGAAGGG + Intronic
962210287 3:133471898-133471920 TTTCAGCAGCAGAGGGAGAAGGG + Intronic
962217790 3:133537603-133537625 TATGAGCCTCAGAGAGAGAGTGG - Intergenic
964890395 3:161527623-161527645 CTTGAGGATAAGATGGAGAAGGG + Intergenic
965642905 3:170849773-170849795 TTTGATGATGAAATGGAGAGAGG - Intronic
965824325 3:172715603-172715625 CTGGAGCATCAGATGCAGGGAGG + Intergenic
967208055 3:187141806-187141828 TTTGAGCATCAGCTGTAGTTGGG - Intronic
967436390 3:189451750-189451772 TTTGAGAATTAGATGCAGTGAGG + Intergenic
969784620 4:9445123-9445145 TTTGATCAAAAGATGGTGAGAGG + Intronic
970870210 4:20808318-20808340 TTTTTGCATCACATGGACAGAGG - Intronic
971017418 4:22502753-22502775 TTTTACTATCAGATGAAGAGTGG + Intronic
971559194 4:28053727-28053749 TTTGAGCATCTGCTAGATAGAGG - Intergenic
972864974 4:43220710-43220732 TTTGAGCATGAGAAAGAGTGTGG + Intergenic
974138855 4:57855057-57855079 TTTAAGCCTCAGATTGAGATAGG - Intergenic
974488624 4:62535177-62535199 TTTCAGCATCAGATATGGAGAGG + Intergenic
975181996 4:71357016-71357038 GTTGACCATCAGATTGAGACAGG + Exonic
976807260 4:89062389-89062411 TTTGAGTACCAGAAGGAGAAGGG - Intronic
977189653 4:93984080-93984102 TTTGAGAGACAGAGGGAGAGAGG + Intergenic
977677272 4:99761949-99761971 TTTGACCAAAAGGTGGAGAGAGG - Intergenic
978195108 4:105962552-105962574 TTTGAGCATCAGATGAAAGTTGG + Intronic
979117246 4:116841128-116841150 TTTGAGAATCAGATGGAAAATGG - Intergenic
979197681 4:117940348-117940370 TTGGAGTATCAGAAGGAGATGGG - Intergenic
979306815 4:119155255-119155277 TTTCAGCATGAGATTTAGAGGGG + Intronic
980424142 4:132604055-132604077 TTTGAGTATCAGATTTGGAGAGG - Intergenic
982277543 4:153651924-153651946 TTTTAGCATCAGATGGACTCGGG - Intergenic
985375595 4:189334089-189334111 ATAGAGCATCATATGGTGAGGGG + Intergenic
989120572 5:38000532-38000554 TTTCAGGATCAAATGGACAGAGG + Intergenic
989267064 5:39487087-39487109 TTTCAGCAGCTGATGGATAGTGG + Intergenic
989503564 5:42198565-42198587 TTTAAACATCAGATGGAGGCTGG - Intergenic
989651075 5:43690832-43690854 TTTGTGGGTCAGAGGGAGAGAGG - Intronic
991592101 5:68263998-68264020 GTTAATCATCAGATGGACAGAGG - Intronic
991988226 5:72311613-72311635 TCAGAGCATCACATGGCGAGGGG - Intronic
992027607 5:72686014-72686036 TGTGTGCATCAGAGAGAGAGAGG - Intergenic
992680557 5:79148899-79148921 TTTCAGAATCAGGTGTAGAGGGG - Intronic
993996442 5:94729221-94729243 ATTGAGCATCAAATAGAGTGTGG + Intronic
995641995 5:114267438-114267460 TTTGAGTATCAGTTTGAGGGTGG + Intergenic
996252130 5:121348290-121348312 TTTTAGCATCAGTTGGAAATTGG - Intergenic
997044620 5:130299364-130299386 TTTGAGCAACAGAAGGATGGTGG + Intergenic
998150995 5:139757421-139757443 TTTGAGCATCAGATGTAGTGTGG + Intergenic
998397799 5:141830375-141830397 TTAGAGAAACAGAGGGAGAGAGG - Intergenic
999953435 5:156674598-156674620 GTCAAGCATCAGAAGGAGAGAGG + Intronic
1000071533 5:157744422-157744444 TAGGAGCAACAGAGGGAGAGTGG + Intronic
1002798711 6:499832-499854 TTTGAGAATCAAATGGTGAAAGG + Intronic
1003643653 6:7896715-7896737 CTTGAACATCTCATGGAGAGTGG - Intronic
1005457000 6:26030047-26030069 TCTGAGGATCAGATGGACAGGGG - Intergenic
1005771451 6:29077031-29077053 TTTGAGCATGTGAAGAAGAGTGG + Intergenic
1006215981 6:32443109-32443131 ATTGAGCATGGGAGGGAGAGGGG + Intronic
1007842711 6:44729986-44730008 TTTGAGTACTAGATGGAGTGGGG - Intergenic
1008302503 6:49858714-49858736 TTTGAGCATTAGAAAGAGAAAGG - Intronic
1008622047 6:53280209-53280231 TCTGAGAATCAGATCGAAAGAGG + Intronic
1010182849 6:73108104-73108126 TTTGAGGGTAAGATGGAGAAAGG - Intronic
1012853879 6:104478307-104478329 TGTGAGCATCAGATGAGGAAAGG - Intergenic
1013372309 6:109481926-109481948 TTTGAGGATCAGAGGAAGAAAGG - Exonic
1014425394 6:121298660-121298682 ATTGAGCAGCAGAAGAAGAGAGG - Intronic
1015088895 6:129330373-129330395 TTCGACAAGCAGATGGAGAGGGG - Intronic
1017168256 6:151430612-151430634 TTTAAGCATCAGATGGTTAAAGG + Intronic
1021037440 7:15817371-15817393 TTTGAGCATAAAAGGAAGAGTGG + Intergenic
1021188436 7:17592592-17592614 TCTGTGCATCAGAAAGAGAGGGG + Intergenic
1021439596 7:20662802-20662824 TTTGAGAATCTGATTGAGAAAGG + Intronic
1021795877 7:24253929-24253951 TTTCTGCTTCAGATGGAGAAAGG - Intergenic
1022060187 7:26785741-26785763 TTTGGGTATCAGATGGAGCCAGG - Intronic
1022289092 7:28984077-28984099 GATTAGCATCAGATGGAGAATGG - Intergenic
1026680113 7:72460238-72460260 TTTCAGCATGAGATTCAGAGGGG + Intergenic
1029697612 7:102224482-102224504 TTTTAGACTCAGATTGAGAGTGG + Intronic
1031083936 7:117283825-117283847 TTTGGGCAGCCGGTGGAGAGTGG - Intronic
1031522210 7:122779802-122779824 TTGGAGCATGATAGGGAGAGGGG - Intronic
1032521616 7:132549893-132549915 TTTGAACATTAGGTAGAGAGAGG + Intronic
1033168332 7:139061042-139061064 TATGTGCAGCAGATGAAGAGAGG - Exonic
1033174827 7:139114241-139114263 TTTGAGCAGCAGTGGGGGAGGGG + Intergenic
1033323468 7:140360850-140360872 TGTGAGCTTCAGAGGGAGATGGG - Intronic
1035810812 8:2489510-2489532 TTTGAGCAACACAAGGAGAGAGG - Intergenic
1037552813 8:19991657-19991679 TGTCAGCAGCAGATGCAGAGAGG - Intergenic
1039685768 8:39800642-39800664 TTGGAGTATCAGAAGGAGATGGG - Intronic
1041989285 8:63966469-63966491 TTTGAGCATCAAAGATAGAGAGG + Intergenic
1045756553 8:105550019-105550041 TCTGATTATCAGGTGGAGAGAGG + Intronic
1045836830 8:106532223-106532245 TTCTAGCATCACATGGAGAATGG + Intronic
1047454964 8:124999905-124999927 GTTGAGCCTCAGATGGAGGTTGG + Intronic
1048440924 8:134458467-134458489 TTTGTGCCCCTGATGGAGAGGGG + Intergenic
1050148053 9:2591223-2591245 TTTCAACATGAGATGTAGAGGGG + Intergenic
1051069082 9:13140849-13140871 TAAGAGAATCATATGGAGAGAGG - Intronic
1052728963 9:32262892-32262914 CTTGAGCCTCAGATGGAAGGAGG - Intergenic
1053281121 9:36820312-36820334 TTTGAGCAGCAGAGGAGGAGAGG - Intergenic
1053290030 9:36873704-36873726 TTTGAGCATCAGATGGAGAGAGG - Intronic
1053504981 9:38634879-38634901 TTGGAGCATCAGTTTTAGAGAGG + Intergenic
1055024103 9:71701019-71701041 TTTGAGCAACAGATGAAGGTGGG - Intronic
1055861276 9:80752365-80752387 TTTCAGCATGAGATTTAGAGAGG - Intergenic
1056898269 9:90571945-90571967 TTTGATCTTCAGTTAGAGAGAGG + Intergenic
1058591187 9:106566666-106566688 TTTGAGTACCTGATGGAGATGGG + Intergenic
1060866812 9:127006915-127006937 TTTGTGCATGAAAGGGAGAGAGG + Intronic
1203561842 Un_KI270744v1:64248-64270 TCTCAGCCTCCGATGGAGAGTGG + Intergenic
1186288840 X:8074434-8074456 TGTGAACTGCAGATGGAGAGAGG - Intergenic
1187040999 X:15595609-15595631 CTTGAACATCAGTTGGAAAGTGG + Intronic
1187827910 X:23351168-23351190 TCTGAGCAACAGATGGAGTTTGG - Intronic
1188932746 X:36133667-36133689 TTTGAACATGAGATTTAGAGGGG + Intronic
1189998447 X:46661730-46661752 TTGGAGCATCAGTTTTAGAGGGG - Intronic
1191724931 X:64269286-64269308 TTTGTTCATGAGATGGGGAGAGG + Intronic
1192938310 X:75884661-75884683 TTTGAGCATGTGAAGAAGAGTGG - Intergenic
1195493033 X:105495707-105495729 TGTGAACATGTGATGGAGAGGGG + Intronic
1197902944 X:131393026-131393048 TGTCACCAGCAGATGGAGAGAGG + Intronic
1198235478 X:134732827-134732849 TGTGGGCATCAAGTGGAGAGTGG + Intronic
1198708118 X:139471770-139471792 TCTGGGCTTCAGATGGAAAGGGG - Intergenic
1199326733 X:146507430-146507452 TTGGAGAATCAGAAGGGGAGAGG + Intergenic
1199644081 X:149888076-149888098 TTCCTGCATCAGATGGAAAGAGG + Intergenic
1200642940 Y:5745542-5745564 TATGAACATTAGTTGGAGAGGGG + Intergenic