ID: 1053295045

View in Genome Browser
Species Human (GRCh38)
Location 9:36906691-36906713
Sequence GGGGCTGGTGGGAGAGCTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 817
Summary {0: 1, 1: 0, 2: 6, 3: 64, 4: 746}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053295045_1053295058 15 Left 1053295045 9:36906691-36906713 CCGCAAGCTCTCCCACCAGCCCC 0: 1
1: 0
2: 6
3: 64
4: 746
Right 1053295058 9:36906729-36906751 TAAGTCTGACTCCCTGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053295045 Original CRISPR GGGGCTGGTGGGAGAGCTTG CGG (reversed) Intronic
900146543 1:1161205-1161227 AGGGCTGGGGGCAGAGCCTGGGG - Intergenic
900177069 1:1295649-1295671 GGGGCTGGTGGCAGGGCTCTGGG - Intronic
900291173 1:1924210-1924232 GGGGGTGGTCGGTGAGCTGGCGG - Intronic
900291604 1:1926074-1926096 GCGGCTGGTGTGAGGGCCTGGGG + Intronic
900300831 1:1976269-1976291 GGGCCTGGTGGGAGGTGTTGGGG + Intronic
901060691 1:6470647-6470669 GGGGCAGGTGAGGGAGCTTCAGG + Intronic
901276677 1:7996944-7996966 GGGCCTGGTGGGAGACGTTTGGG - Intergenic
901321976 1:8345596-8345618 GGGGCTGGAGGGCGAGGTTCGGG + Intergenic
901672835 1:10866332-10866354 GGGGCTGGTGGGGGGGCAGGTGG - Intergenic
901678946 1:10902142-10902164 AGGGCTGTTGGGAGAACCTGAGG - Intergenic
901781524 1:11597811-11597833 GGGGCTGTTGGAAGAGCCAGAGG - Intergenic
901815131 1:11789407-11789429 GGGGCTTGGGGCAGAGCATGGGG + Exonic
902092341 1:13913487-13913509 CTGGATGGTGGGAGAGTTTGGGG + Intergenic
902304071 1:15524137-15524159 GCGGCTGGTGGAAGAGCTGCAGG - Exonic
902676167 1:18009853-18009875 GTGCCTGGTGGGAAAGCCTGAGG + Intergenic
902680369 1:18039707-18039729 GGGGCTGGTAGGAAAGATGGAGG + Intergenic
902756656 1:18553372-18553394 GGGACTGGAGGGAGAGCTGGAGG - Intergenic
903063614 1:20686215-20686237 GGGGGTGGTGGGAGGCCTTGGGG - Intronic
903177659 1:21590374-21590396 GGGCGTGGTGGGGGAGCCTGTGG - Intergenic
903342387 1:22662555-22662577 GGGGCTAGTAGGAGAGGCTGAGG - Intergenic
903373796 1:22853380-22853402 GGGGCTGGTGCCAGACCTCGGGG + Intronic
903445324 1:23419025-23419047 GTGCCTGGGGGGAGAGCTGGTGG - Intronic
903774059 1:25781687-25781709 GGGGGTGGTGGGGGAGATAGGGG - Intronic
903774916 1:25786864-25786886 GGGCCTGGCGGGGGAGCCTGGGG - Intergenic
904293496 1:29502796-29502818 GGAGCTGGTGGCAGAGGTTTGGG + Intergenic
904307350 1:29598805-29598827 GGGGCATGTGGGTGACCTTGGGG + Intergenic
904377439 1:30090572-30090594 CTGGCTGGTGGGAGGGCCTGGGG + Intergenic
904396388 1:30225147-30225169 GGGGCAGGTGAGTGACCTTGGGG - Intergenic
904396417 1:30225295-30225317 GGGGCAGGTGGGTGACCTTGGGG - Intergenic
904455966 1:30648220-30648242 GGGCCTGGTGGGAGGGCTTTTGG + Intergenic
904741936 1:32684192-32684214 GGGGATGGTGGGAGGGCTTAGGG - Exonic
905166957 1:36088539-36088561 GGGCCCGGTGGGAGGGCTTGGGG + Intergenic
905242510 1:36589951-36589973 GGGGCTGGTGGGAGAGGGTTGGG + Intergenic
905365304 1:37448050-37448072 GGGGCTGGCGGGAGTCCTAGGGG + Intergenic
905375873 1:37519875-37519897 GGGCCTGGTGGGAGGGATTTAGG - Intergenic
905382559 1:37573462-37573484 GGGGATAGTAGGAGAGCTTCTGG + Intronic
905533753 1:38702367-38702389 TGGGTTGATGGGGGAGCTTGAGG + Intergenic
905807481 1:40887290-40887312 GGGGGTGGTGGCAGAAATTGGGG + Intergenic
905965788 1:42094056-42094078 GGGCCTGGTGGGAGATGTTTGGG - Intergenic
906847806 1:49213382-49213404 GGGCCTGGTGGGAGATGTTTGGG + Intronic
907010645 1:50959919-50959941 GGGGCTGGCGGGCGAGCCGGCGG + Exonic
907118609 1:51990274-51990296 GGGGCTGGGAGGAGAGATGGGGG - Intronic
907217438 1:52877116-52877138 GGGGCTGGGGGGAGAGGGGGAGG - Intronic
907339926 1:53727629-53727651 GGGCCAGGTGGAGGAGCTTGGGG - Intronic
907406079 1:54254285-54254307 GGGGCAGGTGAGAGAGCATGCGG - Intronic
907425589 1:54377265-54377287 GGGCCTGGAGGCAGACCTTGTGG - Intronic
907819080 1:57949168-57949190 GGGGCTGGGGGGATGGTTTGGGG + Intronic
908206786 1:61858657-61858679 GGGCCTGGTGGGAGATGTTTGGG - Intronic
908583249 1:65540353-65540375 GGGCCTGGTGGGAGATATTTGGG + Intronic
908690334 1:66772458-66772480 GGGCCTGGTGGGAGGTGTTGGGG - Intronic
909527433 1:76642540-76642562 GGGACTGGTGGGAGAAGTTTGGG + Intergenic
909957718 1:81800820-81800842 GGAGCTGGAGGCAGAGCTCGGGG + Intronic
910104370 1:83615549-83615571 GCAGCTGCTGGGAGAGCTGGGGG - Intergenic
910163494 1:84298802-84298824 GGGGCTGCTGGCAGTGCTCGGGG + Intronic
910903974 1:92153937-92153959 GGGCCTGGTGGGAGGGATTTGGG + Intergenic
911009472 1:93263885-93263907 AGGGCTGGTGTGAGTGCCTGAGG + Intronic
911080599 1:93925790-93925812 GTGGCTGGTGGGAGTGAGTGGGG + Intergenic
911284087 1:95969128-95969150 GGGCCTGGTGGGAGGGTTGGGGG - Intergenic
911737741 1:101355952-101355974 GAGGGTGGAGGGAGATCTTGAGG + Intergenic
912659271 1:111513937-111513959 GGAGCTGGTGGGAGGGGCTGTGG + Intronic
913032423 1:114922604-114922626 GGGCCTGGTGGGAGGGGTTTGGG - Intronic
913198561 1:116477638-116477660 GGAGCTGGCAGGAGACCTTGAGG + Intergenic
913289954 1:117262817-117262839 GGGGCTGATGGTGGAGCTTCAGG - Intergenic
913485158 1:119327308-119327330 GGAGCTAGCGGGAGGGCTTGGGG - Intergenic
914973497 1:152333952-152333974 GGGGTTGGGGGGAGAGGTGGAGG - Intergenic
915139189 1:153756141-153756163 GAGGCTGGTGGGAACACTTGAGG + Intronic
915170890 1:153976731-153976753 CTGGCTGGTGGAAGAGTTTGTGG - Exonic
915758879 1:158290969-158290991 GAGGATGGTGGCAGAGCATGGGG + Intronic
915885238 1:159714677-159714699 GGGGCAGGTGTCAGAGCTTCGGG + Intergenic
915972690 1:160365558-160365580 GGGGCAGGTGGGGGAGCTTGGGG + Intergenic
916008230 1:160681031-160681053 GGAGGTGGTGGTAGAGCTGGTGG + Intronic
916202879 1:162288398-162288420 GGGGCTAGAGGGAGAGAGTGTGG + Intronic
917730949 1:177874329-177874351 GTGGATGGGAGGAGAGCTTGGGG - Intergenic
918157609 1:181864568-181864590 GGGCCTGGTGGGAGATGTTTGGG - Intergenic
918390547 1:184055339-184055361 GGGCCTGGTGGGAGATGTTTGGG - Intronic
918448731 1:184639352-184639374 GGGGCTGGGGGTACAGCATGTGG - Intergenic
919717133 1:200790347-200790369 GGGGCTGGGGGGAAGGGTTGGGG + Intronic
919780734 1:201219130-201219152 GGGGCAGGTGGGCCAGCTTGGGG - Intronic
919947022 1:202327061-202327083 GGGGCTCAGGGGAGAGCCTGTGG - Intergenic
920195490 1:204223551-204223573 AGGGGAGGTGGGAGGGCTTGGGG + Exonic
920298727 1:204975614-204975636 GGAGCTGGTGGGAGAGAGGGAGG - Intronic
920531136 1:206703465-206703487 GGGGCTGCTTGGAGAGCAGGTGG + Intronic
921685306 1:218082982-218083004 GGGGCTGGTGGGAGTCAGTGGGG - Intergenic
922542391 1:226429191-226429213 GGAGCTGGGGAGAGAGCGTGGGG + Intergenic
922781413 1:228256034-228256056 GGGGTTGGTGGGATAGTTTCAGG - Intronic
923023655 1:230187433-230187455 GGGGCTGGGGTGAGTGCTTTTGG + Intronic
923391050 1:233515041-233515063 GCGGCTGCAGGGAGAGCATGGGG + Intergenic
924201057 1:241659039-241659061 GGGTGTGGAGGGAGAGCATGAGG - Intronic
924732172 1:246722391-246722413 GGGCCTGGTGGGAGATGTTTGGG - Intergenic
1063011655 10:2027428-2027450 GATGATGGTGGGAGGGCTTGGGG + Intergenic
1063453646 10:6168191-6168213 GAGGCTGGTGGAAGATCATGAGG + Intronic
1063652069 10:7947621-7947643 GGGGCTGCTGCGAGAGCGTTGGG + Intronic
1063874692 10:10461827-10461849 GGGGATGGTGGGAGGGCTACAGG - Intergenic
1064272397 10:13877550-13877572 AGAGCTGCAGGGAGAGCTTGGGG + Intronic
1064339326 10:14472519-14472541 GGGGCTGGAGGGAGAGCCCAGGG - Intergenic
1064464193 10:15562918-15562940 GGGCCTGGTGGGAGATGCTGGGG + Intronic
1064574461 10:16730243-16730265 GGGCCTGGTGGGAGGTCTTTGGG - Intronic
1064598806 10:16972759-16972781 GGGGCTGGTGATAGAGATGGTGG - Intronic
1065945554 10:30602721-30602743 GAGGCTGATGTGAGAGTTTGAGG + Intergenic
1066577568 10:36843355-36843377 GGGCCTGGTGAGGGAGCTGGGGG + Intergenic
1067108062 10:43378521-43378543 GGGGCTGTGGGGAGAGGTAGGGG + Intergenic
1067217777 10:44316802-44316824 AGGGCTGGTGGGAGGGGCTGAGG - Intergenic
1067237075 10:44460090-44460112 GGGACTGGGGAGAGAGCATGAGG - Intergenic
1069070280 10:63985008-63985030 GGGACTGGTGGGAGATGTTTGGG + Intergenic
1069371337 10:67750735-67750757 GGGGCTGGTGAAAGCCCTTGGGG + Intergenic
1069474011 10:68717492-68717514 GGAACTGGTGAGAGAGCCTGAGG - Intergenic
1069778057 10:70938221-70938243 GTGGCTGATGGGAGAGTTTCCGG + Intergenic
1069892064 10:71658081-71658103 GGGGCTGGGGTGGGAGCTGGAGG + Intronic
1070470546 10:76775067-76775089 GGAGCTGGTGTGAGTGCTTTTGG + Intergenic
1070730391 10:78823645-78823667 GGGTCTGGTGGTATAGTTTGTGG + Intergenic
1070916683 10:80159620-80159642 GTGGCAGGTGGGAGATTTTGGGG - Intronic
1072199551 10:93145891-93145913 GGAGCTGGTGAGAGAGCTGGCGG - Intergenic
1072362847 10:94676863-94676885 GGGCCTGGTGGGAGATGTTTGGG + Intergenic
1072972311 10:100028026-100028048 GGGCCTGGTGGGAGATGTTTGGG - Intergenic
1073181881 10:101588347-101588369 CGGGCTGGTTGGAGAGTCTGCGG + Exonic
1073947888 10:108773268-108773290 GGGGCTGGTGGGCAGTCTTGGGG - Intergenic
1074187413 10:111108723-111108745 GGGGGTGGAGGGAGAGCATGTGG + Intergenic
1074734003 10:116409019-116409041 GGGCCTGGTGGGAGGTGTTGGGG - Intergenic
1075193883 10:120337582-120337604 GGGACAGGTGGGACACCTTGGGG + Intergenic
1075266816 10:121007580-121007602 GGGGGTGGTGGGGGAGCTCCCGG + Intergenic
1075378170 10:121996455-121996477 GGGCCTGGTGGGAGGTCATGGGG - Intronic
1075799144 10:125141997-125142019 GGGGCTGGTGGGACACAGTGTGG + Intronic
1076872127 10:133199337-133199359 GGGGCTGGGGGAAGGGCGTGGGG - Intronic
1077186097 11:1236073-1236095 GAGGCTGGTGTGAGGGCGTGGGG + Intronic
1077412702 11:2410914-2410936 GGGGCTGTGAGGAGAGCTGGAGG + Intronic
1077537734 11:3132542-3132564 TGGGGTGGCGGGAGGGCTTGGGG - Intronic
1077886879 11:6393342-6393364 GTGGCTGGTGGGGGAGCTTCAGG + Exonic
1079021353 11:16911756-16911778 GGAGCAGGTGGGAGAGCGTGGGG - Intronic
1079299832 11:19268072-19268094 GGGCCTGGTGGGAGATGTTTGGG - Intergenic
1080044747 11:27797191-27797213 GGGGCTTGTGGGAGAGGCAGTGG + Intergenic
1080649049 11:34208684-34208706 GGGGCTGGTGGAAGAGGAGGTGG - Intronic
1080698651 11:34625024-34625046 GGGGGTGGTGGGAGTACCTGGGG + Intronic
1080896712 11:36454162-36454184 GGGGGTGGCGGTAGAGCATGTGG - Intronic
1081545222 11:44066680-44066702 TGGGCTGTCGGGAGAGCTGGAGG + Exonic
1081756005 11:45545018-45545040 GGGGCTGGTGACAGAGCTAAAGG - Intergenic
1082796480 11:57381508-57381530 GGAGCTGGTGGGAGACAATGGGG + Intergenic
1082935921 11:58656588-58656610 GGGGCTGGAGGGAGGGAATGCGG - Intronic
1082989000 11:59191352-59191374 GGGGGAGGCGGGAGAGATTGAGG - Intronic
1083378524 11:62245355-62245377 GGAGCTCTTGGGAGAGCTTGAGG - Intergenic
1083384221 11:62295721-62295743 GGAGCTCTTGAGAGAGCTTGAGG + Intergenic
1083452238 11:62753839-62753861 GGAGCTAATGGGAGAGCTTTGGG - Intronic
1083460237 11:62806264-62806286 GGGGCTGGTGGTGGTGCTTTTGG - Exonic
1083882959 11:65557561-65557583 AGGCCCGGTGGGAGAGCTAGTGG - Intronic
1084143560 11:67250583-67250605 GGGGCTGGGGGGAGAGGAGGAGG + Exonic
1084149818 11:67282849-67282871 GGGGCTGGGGGGAGCTCCTGTGG + Intronic
1084925593 11:72508812-72508834 GGGCCTGGTGGGAGGGGTTTTGG - Intergenic
1084948991 11:72654420-72654442 AGTGCAGGTGGGAGAGCCTGGGG + Intronic
1085197648 11:74682137-74682159 GGGGCTGGGGGGCTAGCTCGAGG + Intergenic
1085423565 11:76383445-76383467 GGGGCAGGTGGAACAGCATGAGG + Intronic
1085948713 11:81303920-81303942 GGGGCAGGTGAGGGAGCTGGGGG + Intergenic
1086895661 11:92309275-92309297 AGGGCTGGGGGGAGAGCTCTAGG - Intergenic
1087303053 11:96457751-96457773 GGGCCTGGTGGGAGATGTTTGGG + Intronic
1087773107 11:102232260-102232282 GGGGAGGGTGGGAAAGTTTGGGG + Exonic
1088743362 11:112784871-112784893 GGGGCTGGTCGGTGAGCATCAGG + Intergenic
1089646973 11:119886801-119886823 GGGGCTGGTCTTAGAGCATGAGG + Intergenic
1090104149 11:123833845-123833867 GGGGCTGGTGGTTGGGCATGAGG + Intergenic
1090334429 11:125953354-125953376 CCGGCTAGTGGGAGGGCTTGGGG - Intergenic
1090429386 11:126633398-126633420 GGGGCTGGTGGGAGGTGTTTGGG + Intronic
1090594922 11:128310801-128310823 GGGCCTGGTGGGAGGTGTTGGGG + Intergenic
1090873332 11:130767210-130767232 GGGGGTGGTGGGAGAGGGAGAGG + Intergenic
1091011143 11:132001667-132001689 GGGCCTGGTGGGAGATGTTTGGG - Intronic
1091761105 12:3087950-3087972 AGGGCTTGTCGGAGAGCTTTGGG - Intronic
1092006931 12:5077903-5077925 GGAACTAGTGGGAGAGCTTTGGG - Intergenic
1092137397 12:6159497-6159519 GGGGCTGCGCGCAGAGCTTGCGG + Intergenic
1092230801 12:6774257-6774279 GGGGAGGGGGGGAGAGCATGGGG + Intronic
1092232371 12:6783272-6783294 GGGGCTGGGGGCAGGGTTTGAGG - Intergenic
1092500902 12:9046032-9046054 GGGGCAGGTGGGAGAGCATCAGG + Intergenic
1092554560 12:9543215-9543237 GGGGATGGTGGGATGGCTTCAGG + Intergenic
1093074846 12:14747263-14747285 GGGCCTGGTGGGAGATGTTTGGG + Intergenic
1093415157 12:18911376-18911398 GGGGTTGTTGGGAGTGCTTTTGG + Intergenic
1093715970 12:22382071-22382093 GGTGGTGGTGGGAGTGCTGGGGG + Intronic
1093754048 12:22832720-22832742 GGCTCTGGTGTGAGAGTTTGAGG + Intergenic
1094462787 12:30715500-30715522 GGGGCTGGGGGGAGAGGAGGAGG + Intronic
1094517539 12:31147420-31147442 GGGGATGGTGGGATGGCTTCAGG - Intergenic
1095259857 12:40085398-40085420 GGGGGTGGTGGCAGGTCTTGAGG + Intronic
1095265049 12:40146036-40146058 GGGGGTGAGGGGAAAGCTTGGGG + Intergenic
1095956895 12:47812114-47812136 GGGGCTGCTGTGCCAGCTTGGGG - Intronic
1096262988 12:50104482-50104504 GGGGCTGCTGTGAGATCCTGAGG + Intronic
1096418738 12:51437379-51437401 GGGTCTGGTGGGAGATGTTTGGG + Intronic
1096555075 12:52398852-52398874 CGGGCTGGAGGGGTAGCTTGAGG - Intronic
1096789470 12:54035863-54035885 GGGGGTGTTGGGAGAGTTGGAGG + Intronic
1096929356 12:55188549-55188571 GGGTCTGTTGGGAGGGCATGAGG + Intergenic
1097249780 12:57626246-57626268 GGGGCTGGGGTGAGGGCTGGTGG - Exonic
1098899067 12:76094169-76094191 GGGCCTGGTGGGAGATGTTTGGG + Intergenic
1099222741 12:79934530-79934552 AGGGCGGGAGGGAGAGCTGGTGG - Intronic
1099854978 12:88152404-88152426 GGGCCTGGTGGGAGATGTTTGGG - Intronic
1100385222 12:94099749-94099771 GGGGGTTGTGGGAGGGCTTCTGG + Intergenic
1100408158 12:94288789-94288811 GTGGCTGCTGGGACAGCATGTGG + Intronic
1100618638 12:96250503-96250525 GGTGCTGGTGGGTGAGTTTCTGG - Intronic
1101072994 12:101096343-101096365 GGGTCTGGTCTGTGAGCTTGAGG + Intronic
1101303749 12:103506290-103506312 GGGGGTGGTGGGATGGCGTGGGG - Intergenic
1101320119 12:103666077-103666099 GGGGCTGGTGGGAGGAGTTTAGG - Intronic
1101373619 12:104152417-104152439 GGGGTTGGTGGTGGGGCTTGGGG - Intergenic
1101422849 12:104563741-104563763 GGATCTGGTGGGAGTGGTTGTGG + Intronic
1101510844 12:105391058-105391080 GGGCCTGGTGGGAGGTCTTTGGG - Intronic
1102473687 12:113175020-113175042 CGGGCTGGTGCGTGAGCTGGGGG - Exonic
1103265586 12:119627657-119627679 GGGCCTGGTGGGAGATGTTGTGG - Intronic
1103544064 12:121687234-121687256 GGCGCTGGTGGCCGAGTTTGGGG + Intergenic
1103741212 12:123092833-123092855 GGGGCTCGGGGGAGAGGTCGAGG - Intronic
1104795214 12:131512366-131512388 GGTGCTGGTGGGAGCTCATGTGG - Intergenic
1104832907 12:131766575-131766597 GGGGCTGGCAGGAGGGCTTGGGG + Intronic
1105421139 13:20253482-20253504 GGGCCTGGTGGGAGAGGTTTGGG - Intergenic
1106274419 13:28190426-28190448 GGGGGTGGGGGTAGAGATTGGGG + Intronic
1106606706 13:31235186-31235208 GGGGCTGCTGAGTGAGATTGAGG + Intronic
1107614665 13:42152893-42152915 GGGGCAGGTGTGAGTGCTTTTGG + Intronic
1107800242 13:44099639-44099661 GGACCTGGTGGGAGATCATGGGG - Intergenic
1107804573 13:44141990-44142012 CGGCCTTGTGGGAGAGCTAGTGG - Intergenic
1109769003 13:66945261-66945283 GGGGCTGCTGGGGGAGTGTGAGG - Intronic
1109913794 13:68953068-68953090 GGGGCTGGGGGCAGAGGTTAAGG + Intergenic
1111893362 13:94110455-94110477 GGGGCCGAAGGGAGATCTTGAGG + Intronic
1113593823 13:111518038-111518060 GGGGCTGGTGAGGGAGCCGGGGG - Intergenic
1113593935 13:111518273-111518295 GGGGCAGGTGAGGGAGCTGGAGG - Intergenic
1113941906 13:114022863-114022885 GGGGCTGGTGTGAGTCCCTGGGG + Intronic
1114270543 14:21098044-21098066 GGGCCAGGTGGAAGAGCTGGGGG - Intronic
1114327011 14:21599729-21599751 GAGGCTGGGAGGAGAGCTTGAGG - Intergenic
1114408604 14:22479384-22479406 GGGACTGGTGGAAGAGTTTACGG - Intergenic
1114529122 14:23384519-23384541 GGAGCTGGAGGGTGAGCTGGAGG - Exonic
1114660169 14:24338783-24338805 GGGGCTGGTGGGGCAGCTGGTGG + Intronic
1114989937 14:28273808-28273830 GGGCCTGGTGGGAGGCCATGGGG - Intergenic
1115273596 14:31581739-31581761 GGGGCTTGGAGGAGAGGTTGGGG + Intronic
1117279201 14:54220619-54220641 GGGGCTGGAGGGAGGGGGTGGGG + Intergenic
1117390400 14:55256810-55256832 GGAGCTGGGGTGAGAGCTTTTGG - Intergenic
1118599821 14:67464287-67464309 GAGGCTGCAGGGAGAGCCTGGGG - Intronic
1118809374 14:69261800-69261822 GGGGCGGGGGGGTGAGGTTGTGG + Intronic
1119741293 14:77015280-77015302 GTGGCTGGTGGGAGAGGGAGGGG + Intergenic
1119859554 14:77926284-77926306 AGGTCTTGTGGGAGAACTTGGGG - Intronic
1120879470 14:89403781-89403803 GAGGCTGCTGGGAAAGCTTCTGG - Intronic
1121445969 14:93979256-93979278 GTGGGTGGTGGGAGCTCTTGAGG - Intergenic
1121451319 14:94010066-94010088 GGTGCTGCTGGGAGAGGGTGGGG + Intergenic
1121484796 14:94306311-94306333 GGAGCTGGAGGGAGCGCATGAGG - Intronic
1121525837 14:94618751-94618773 GTGGCTTGTGGGAGGGCTTTGGG - Intronic
1121564285 14:94896890-94896912 GGTTCTGGTGGGGGATCTTGGGG - Intergenic
1121570958 14:94946211-94946233 GGGGGTGCTGGGAGAGGTGGGGG + Intergenic
1121843925 14:97156718-97156740 GGGGCTGCTGTCAGAGGTTGAGG + Intergenic
1121855974 14:97270601-97270623 TGGGGTGGTGGGAAAGCATGGGG + Intergenic
1121878773 14:97480302-97480324 TGGGCTACTGGGTGAGCTTGAGG + Intergenic
1121996488 14:98607221-98607243 GGGGCTGGGTGCAGAGCATGGGG + Intergenic
1122247594 14:100414964-100414986 GGGGCTGGGGTGAGAGCAGGGGG + Intronic
1122272731 14:100575634-100575656 GGGGCTGGTGGGGGAAGGTGGGG + Intronic
1122629256 14:103099760-103099782 GGGGCTGGGGGGAGGGTTTTAGG + Intergenic
1122632404 14:103113005-103113027 GGGCCTGGGGGCTGAGCTTGGGG - Intergenic
1122784348 14:104156949-104156971 GGGGGTCCTTGGAGAGCTTGGGG + Intronic
1122831437 14:104399067-104399089 GGGCCTGGTGGGAGATGTTTGGG + Intergenic
1122993998 14:105252923-105252945 GTGGCTGGTGGGAGCACATGTGG - Intronic
1123070791 14:105641594-105641616 GGGGATGGGGGGATAGCGTGGGG + Intergenic
1124258911 15:28168886-28168908 TGGGCTGCTGTGAGAGCCTGAGG + Intronic
1124566767 15:30823279-30823301 TGGGCTGCTGTGAGAGCCTGAGG - Intergenic
1125084823 15:35717489-35717511 GGGGCTGGAGGGAGATCTGTGGG + Intergenic
1125726363 15:41870257-41870279 GGGGCTGGAGCGAGAACTCGTGG - Exonic
1126013063 15:44321487-44321509 GGGGGTGGGGGGATAGCATGAGG + Intronic
1126440980 15:48688063-48688085 GGGGCGGGAGGGAGAGCATTAGG + Intergenic
1127398028 15:58558677-58558699 GGGGCAGGGGGGATAGCTTCAGG - Intronic
1127940340 15:63688881-63688903 GGGGCTGGGGGAAGGGTTTGAGG + Intronic
1127980629 15:64032517-64032539 GGGGCAGGTTGGAGAGGCTGGGG - Intronic
1128149634 15:65355147-65355169 GGGGCGGGTGGGGGAGCCTGGGG + Intronic
1128357658 15:66939573-66939595 GGGTCTGGTGGCAGAGCTCTGGG - Intergenic
1128651059 15:69414151-69414173 AGGGCTGGAGGGAGATCTTGAGG - Intergenic
1129242951 15:74262262-74262284 TGGGCTGGCAGGAGAGCTGGGGG + Intronic
1129479002 15:75808233-75808255 GGGGCTGGAGGGAGACCTCATGG - Intergenic
1129604128 15:77016508-77016530 GAGGCTGGGGGGACAGCTTCTGG + Intronic
1130752260 15:86724690-86724712 GGGCCTGGTGGGAGGTGTTGGGG + Intronic
1130902219 15:88215562-88215584 GGGGCTGGGAGGAAAGCTGGGGG + Intronic
1131308288 15:91265174-91265196 TGGCCTGGAGGGAGAGCTTAGGG + Intronic
1131850438 15:96537436-96537458 GGGGCTGGTTGGGGGGCTGGGGG - Intergenic
1132594028 16:740211-740233 CGGGCTGCTGGGAGCGCTTCCGG - Intronic
1132598352 16:763205-763227 GGGGCAGAGGGGACAGCTTGGGG - Intronic
1132599854 16:768586-768608 AGGGCTGGGGGCAGAGCTGGGGG + Intronic
1132608753 16:804706-804728 GAGGGTGGTGGGAGGCCTTGAGG + Intergenic
1132676271 16:1122573-1122595 GGGAATGGAGGGAGAGCGTGTGG + Intergenic
1132695714 16:1200929-1200951 GGGGAGGGAGGCAGAGCTTGCGG + Intronic
1132871252 16:2116722-2116744 GGGGCTGGTGGGGGGGTTTTCGG - Intronic
1132973219 16:2698956-2698978 GGTGCAGGTGGGAGAGTCTGCGG + Intronic
1133385010 16:5362698-5362720 GGGGCTGAGGGGAGAGGGTGGGG - Intergenic
1134602292 16:15542858-15542880 GGGGCTGGGGTGAGTGCTTTTGG + Intronic
1135240142 16:20798163-20798185 TTTGCTGGTGGGAAAGCTTGGGG + Exonic
1135382994 16:22009002-22009024 GTGGGTGCTGGGAGAGCTGGTGG + Intronic
1135406577 16:22202515-22202537 GGGGCTGGGAAGGGAGCTTGGGG - Intergenic
1135537087 16:23302620-23302642 GGGGCGGAGGGGAGAGCTGGAGG + Intronic
1135795353 16:25436061-25436083 GAGGCTGGAGTGATAGCTTGTGG + Intergenic
1136138573 16:28274045-28274067 GGGGCTGGCGGGAGAGAGGGAGG + Intergenic
1136476681 16:30517874-30517896 GGAGCTGGTGGGAGAGATCGAGG + Exonic
1136545837 16:30954125-30954147 GGGGAGGCAGGGAGAGCTTGTGG + Exonic
1136996020 16:35188468-35188490 GGGCCTGGTGGGGGAGGTTGGGG + Intergenic
1137447182 16:48539075-48539097 GTGGCTGCAGGGAGAGTTTGGGG + Exonic
1137518995 16:49175668-49175690 AGGGCTGCGGGGAGAGCTGGAGG - Intergenic
1137603973 16:49775010-49775032 GGGGCTGGTGGGGCAGCTGCTGG - Intronic
1137606381 16:49789453-49789475 GGGGCTGGTGGAAGAGTTGCAGG - Intronic
1137627114 16:49916194-49916216 GGGGCTGGTGGGAGGTGTTTGGG + Intergenic
1138076664 16:54049565-54049587 CCTGCTGGTGGGAGGGCTTGAGG + Intronic
1138297044 16:55895850-55895872 GGGCCTGGTGGGAGATGTTTAGG + Intronic
1138387338 16:56644617-56644639 GGGGCTGGAGGCACAGCTTGAGG + Intronic
1138606556 16:58093828-58093850 GGAGCTGGTGGAACAACTTGGGG - Intergenic
1139335315 16:66227091-66227113 GGGAGTGGTGGGAGAGGTAGAGG - Intergenic
1139576643 16:67846552-67846574 GGGGCAGCTGGGCCAGCTTGGGG + Intronic
1139971803 16:70781030-70781052 GGGCCTGGTGGGAGGGGTTTCGG + Intronic
1140001886 16:71033637-71033659 GGGGCAGGGGGGAGAGCATCAGG + Intronic
1140137622 16:72221599-72221621 GGTGCTGGAGGGAGAGTATGGGG + Intergenic
1140467160 16:75191702-75191724 GGGGCTGGTGGGAGGTGTTTGGG - Intergenic
1140517404 16:75553970-75553992 GGGGATGGTGGGAGGAATTGGGG - Intronic
1141028367 16:80568553-80568575 GGGGAGGGTGGGAGAGGTGGGGG - Intergenic
1141028380 16:80568587-80568609 GGGGAGGGTGGGAGAGGTGGGGG - Intergenic
1141028404 16:80568655-80568677 GGGGAGGGTGGGAGAGGTGGGGG - Intergenic
1141028427 16:80568723-80568745 GGGGAGGGTGGGAGAGGTGGGGG - Intergenic
1141028439 16:80568757-80568779 GGGGAGGGTGGGAGAGGTGGGGG - Intergenic
1141523781 16:84598652-84598674 GGGGTTGGTGGGGGGGGTTGGGG - Intronic
1141688451 16:85583297-85583319 GGGGCTGCTGGCAGAGCTGCAGG - Intergenic
1141776679 16:86127756-86127778 GGGCTGGGTGGGAGAGCTGGGGG + Intergenic
1141888113 16:86907111-86907133 GTGGCGGGTGGGAGAGCCGGGGG + Intergenic
1141895087 16:86954076-86954098 GGGGCTGGGGGGAGGGCCGGCGG + Intergenic
1141899828 16:86983877-86983899 GAGGCTGGAGGTAGAACTTGAGG + Intergenic
1142102509 16:88282918-88282940 GGGGCTGCTCTGGGAGCTTGAGG - Intergenic
1142179955 16:88663537-88663559 GGGGCTGTGCGGAGACCTTGAGG + Intergenic
1142224921 16:88872660-88872682 GGGGCTGGCGGGAGAGCCGGCGG - Intergenic
1142872095 17:2827690-2827712 TGGGCTGGGAGAAGAGCTTGGGG - Intronic
1143156201 17:4838168-4838190 GGGGCTGTTTGGAGAGCTCGAGG + Intronic
1143179932 17:4978340-4978362 CTGCCTGCTGGGAGAGCTTGGGG + Intronic
1143321549 17:6071776-6071798 GGTGCTGGGGAGAGAGCTAGGGG + Intronic
1143496032 17:7313081-7313103 GGGGCTGGATGCAGAGCCTGGGG + Exonic
1143573101 17:7773371-7773393 AGGGCTGGAGGAAGAACTTGGGG - Intronic
1144676568 17:17165968-17165990 AGGGCATGTTGGAGAGCTTGGGG + Intronic
1144752124 17:17656185-17656207 GGGGCTGGTGGGAGGTGTTGGGG - Intergenic
1145981430 17:29014479-29014501 GGGGCAAGTGAGAGAGCTGGGGG - Intronic
1146375753 17:32293161-32293183 GGGGCTGGAGGGAGGGGGTGGGG + Intronic
1146499787 17:33354521-33354543 AGGGCTGCAGGGAGAGCTGGTGG - Intronic
1146878931 17:36432203-36432225 GGGGAGGGTGGGAGGCCTTGGGG - Intronic
1146882871 17:36453349-36453371 GGGGAGGGTGGGAGGCCTTGGGG - Intergenic
1146923698 17:36730084-36730106 GGGGCTGGTGGCAGGGCCTTGGG - Intergenic
1147192905 17:38747837-38747859 GGGGCAGCCGGGAGGGCTTGCGG - Intronic
1147384671 17:40074264-40074286 GTGGCAGGTGGGAGGGCTGGGGG - Exonic
1147419351 17:40314457-40314479 GGGGCAGGTGGGAGAGTGGGTGG + Intronic
1148155871 17:45425122-45425144 GGGGCTCCTGGGACAGCCTGGGG + Intronic
1148755577 17:49971461-49971483 GGGCCTGGAGGGAGGCCTTGGGG + Intronic
1148759047 17:49989962-49989984 GAGGCTGGTGGCAGCTCTTGTGG - Intergenic
1148792059 17:50178699-50178721 GGGGCTGTTGTGAGAATTTGTGG + Intergenic
1150281438 17:63931562-63931584 GGGGCTGGGGGCAGGGCTTCCGG - Intronic
1150387563 17:64773760-64773782 GGGGCTCTTGGGACAGCCTGGGG + Intergenic
1150574134 17:66414782-66414804 GGGGCTGGTTTGATATCTTGTGG + Intronic
1150969551 17:70011494-70011516 GGGCCTGGTGGGAGGGGTTTTGG + Intergenic
1151572297 17:74932890-74932912 GGGGATGAGGGGAGAGCTGGAGG + Intronic
1151665432 17:75542831-75542853 GTGGCTGGTTGGAGAGGCTGAGG + Intronic
1151675608 17:75595859-75595881 GGGGCTGGAGGGAGAGGAGGTGG + Intergenic
1151684681 17:75639645-75639667 TGGGCTGGTGGGAGAGGTTGGGG + Exonic
1151966089 17:77432548-77432570 GGGGCTGGTGGAACAGCCTGAGG - Intronic
1151979158 17:77498710-77498732 TGGGGTGGTGGGAGGGCCTGGGG - Exonic
1152030305 17:77838090-77838112 AGGGTGGGTGGGAGAGCTGGGGG + Intergenic
1152139642 17:78528893-78528915 GTGTCTGGTGGGAGTGCTGGTGG - Intronic
1152228427 17:79103108-79103130 GGGGCAGGTGGGCGATCTTGGGG + Intronic
1152460681 17:80440736-80440758 GAAGCTGGTGGGAGAGTGTGGGG - Intergenic
1152585126 17:81185911-81185933 GGGGGTGGGGGGAGGGCTTCGGG - Intergenic
1152770554 17:82165628-82165650 TGGGCTTCTGGGAGAGCATGTGG + Intronic
1152800326 17:82327928-82327950 GGGGCTGGTGGACGGGCTGGGGG - Intronic
1153322090 18:3783605-3783627 GGGGCTGTGGGGAGGGCTGGAGG + Intronic
1155170691 18:23265033-23265055 GGGCCTGGTGGGAGATGTTTGGG - Intronic
1155740105 18:29278947-29278969 GGGCCTGGTGGGAGATGTTTGGG - Intergenic
1155856411 18:30839497-30839519 GGGGCTGCGTGCAGAGCTTGTGG - Intergenic
1155988003 18:32251225-32251247 GGGGCAGGTGGGACAGCCTTGGG + Intronic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1157295008 18:46435927-46435949 GGAGCTGGGGAGAGAGGTTGAGG + Intronic
1157551160 18:48582659-48582681 GGTGGTGGTGGGAGTGCTTGCGG + Intronic
1157605717 18:48924713-48924735 GCTGCTGGTGGGGGAGCTGGAGG - Intronic
1158266897 18:55669238-55669260 GAGGCTGATGGGAGAGAATGGGG + Intergenic
1158471805 18:57743664-57743686 GGCGCAGGTGGGAGATCTGGGGG + Intronic
1158855867 18:61542952-61542974 GGGCCTGGTGGGAGGTGTTGGGG - Intronic
1160010322 18:75102427-75102449 GGGGCTGGTGGGAGATGTTTGGG - Intergenic
1160046297 18:75390299-75390321 GTGGGTGCTGGGAGAGCTGGTGG + Intergenic
1160122866 18:76146159-76146181 GGGGCTGGAGGGGGAGCACGGGG + Intergenic
1160225362 18:77007473-77007495 GGGGCTGGAGGGAGAAGTTGAGG + Intronic
1160397188 18:78581064-78581086 GAGGCAGAAGGGAGAGCTTGGGG + Intergenic
1160399350 18:78598763-78598785 TGGGATGGTGGTAGAGCTAGAGG - Intergenic
1160514243 18:79469795-79469817 GGGGCTGGTCAGTGTGCTTGTGG - Intronic
1160742667 19:694731-694753 CAGGCTGGTGGGGGAGCTGGGGG - Intronic
1160803866 19:982908-982930 GAGGCTGGTGCCAGAGCGTGCGG - Intergenic
1160935718 19:1593596-1593618 GGGGGTGGTCGGGGAGCTGGGGG - Intergenic
1161167911 19:2798394-2798416 GGCCCTTGTGGGAGAGTTTGTGG - Intronic
1161320533 19:3638735-3638757 CTGGCTGGTGAGAGAGCATGTGG + Intronic
1161366314 19:3881713-3881735 GGGGCTGGTGGGAGTGTTCCTGG + Intronic
1161453116 19:4357592-4357614 GGGGCTGTTGGGAGAGCCTGGGG + Intronic
1161576755 19:5058622-5058644 GGGGCTGGTCAGACAGCGTGAGG - Intronic
1161604381 19:5206598-5206620 GGGGCCGGTGGGGGGGCTCGAGG + Exonic
1161625225 19:5322560-5322582 CGGGCTGGAGGCAGTGCTTGCGG - Intronic
1161733776 19:5978090-5978112 GGGCCTTGTGGGAGGGCTTAAGG - Exonic
1161779207 19:6279918-6279940 GGGGCTGGCGGGCGAGCGGGCGG - Exonic
1162130887 19:8525661-8525683 GGTGCTAATGGGAGAGCCTGAGG - Intronic
1162758549 19:12874657-12874679 GGGGCTCCGGGGAGAGCTTTGGG - Exonic
1162760510 19:12885848-12885870 GGGGCTGGTGGCTGGGCTTTTGG - Exonic
1162895574 19:13763143-13763165 AGGGCTGGTGGGCGAGCCGGGGG - Exonic
1162967022 19:14160879-14160901 GGGGCAGGAGGGAGAGCTCAGGG - Intronic
1163007887 19:14407827-14407849 GGGGCTGAGGGCAGAGCATGGGG + Intronic
1163190138 19:15671263-15671285 GAGGGTGGTGGGACAGCTTTGGG + Intergenic
1163517890 19:17775808-17775830 GGGGGGGGTGGGAGTGCTGGTGG + Intronic
1164137442 19:22427605-22427627 GGGGCTTGAGGGAGGGCTGGTGG - Intronic
1164448673 19:28339735-28339757 GGGCCTGGTGGGAGATGTTTGGG + Intergenic
1164453662 19:28388718-28388740 GGGGCTGGTGGGAGATGTTTGGG + Intergenic
1164503447 19:28839014-28839036 GGGGCTGAAGGGAGAGCAGGAGG - Intergenic
1164633051 19:29774141-29774163 GGGGCAGGAGGGAAAGCTGGGGG + Intergenic
1164705007 19:30313532-30313554 GTGGCAGGTAGCAGAGCTTGGGG - Intronic
1164889280 19:31809259-31809281 GGGCCTGTTGGGGGAGCTGGGGG + Intergenic
1165830980 19:38730022-38730044 GGGGCTGGTGGGATGGGGTGCGG - Exonic
1166205345 19:41265349-41265371 GGGGTGGGTGGGAGAGGTGGAGG + Intronic
1166385193 19:42376680-42376702 GGGGGTGGTGGGGGTGCTGGGGG + Exonic
1166458632 19:42966667-42966689 GGGGCTGGAGTGAGTGCTTTGGG + Intronic
1166475577 19:43121927-43121949 GGGGCTGGAGTGAGTGCTTTGGG + Intronic
1166734963 19:45078795-45078817 GGGACTGCAGGGAGAGCTGGAGG + Intergenic
1166742165 19:45121199-45121221 AGGAGTGGTGGGAGAGCGTGGGG + Intronic
1166994640 19:46714346-46714368 GGGGCGGGTGTGTGAGCCTGGGG - Intronic
1167045788 19:47048099-47048121 GGGGCTTCAGGGAGAGCTTAGGG - Intronic
1167050253 19:47073710-47073732 GGGGCTGGGGGTAGAGGGTGGGG - Intronic
1167517645 19:49932637-49932659 GGGGCTGGTGGTAGTGGTGGTGG - Exonic
1167571371 19:50290955-50290977 GAAGCTGGAGGGAGAGCTGGAGG + Exonic
1167593419 19:50416094-50416116 GGGGGTGGGGGTAGAGCTGGAGG - Intronic
1167614666 19:50525843-50525865 GGGCCTGGTGGGAGAGGCAGAGG - Intronic
1167707682 19:51091262-51091284 GGGGCTGGTGGGAGAATTAAGGG - Intergenic
1168231138 19:55032367-55032389 GAGCCTGGAGGGAGGGCTTGGGG + Exonic
1168306196 19:55437665-55437687 GGGGCAGATGCGAGAGGTTGTGG + Exonic
925356884 2:3248037-3248059 GGGCCTGGTGGGAGGTATTGGGG + Intronic
925427477 2:3762691-3762713 GGGCCTGGTGGGAGGGGTTTGGG - Intronic
925567733 2:5274376-5274398 GGGACTGTGGGGAAAGCTTGAGG - Intergenic
925928272 2:8685677-8685699 GTGGCTGGGGGGCGAGCGTGCGG - Intergenic
926581131 2:14633659-14633681 CAGGCTGGCTGGAGAGCTTGCGG - Intronic
926680701 2:15661841-15661863 AGGGCCCGTGGGAGAGCTAGCGG + Intergenic
927422079 2:22944324-22944346 GGGGTTGGTGCCAGAGCCTGTGG - Intergenic
927596655 2:24403212-24403234 GGGGCTGGGGGGAGGGCGGGCGG - Intergenic
927855327 2:26524074-26524096 AGGCCTGGTGGGAGAGGTTCTGG - Intronic
927893715 2:26768165-26768187 GGGGTTGTTGGGCCAGCTTGTGG + Intronic
927943181 2:27118576-27118598 GGGGCTGGGGGAAGCGCCTGGGG + Intronic
929168219 2:38905023-38905045 GGTGCTAGTGGCAGAGCTAGTGG + Intronic
929579010 2:43070082-43070104 GGAGCAGGTAGGAGTGCTTGGGG + Intergenic
929587009 2:43122628-43122650 TGGGCTGGTGACAAAGCTTGAGG - Intergenic
929967010 2:46543371-46543393 GGGGCGGGTGGGAGAGGGGGTGG - Intronic
930033576 2:47072363-47072385 GGCGCTGGCTGGAGATCTTGCGG - Intronic
930037529 2:47096331-47096353 GAGGCTGGTGGAAGGGTTTGTGG + Intronic
930057074 2:47260263-47260285 TGGGCTGGTGGTAGAGTTGGAGG + Intergenic
931809851 2:65844254-65844276 GGGGCCGGCAGGAGAGCTGGAGG - Intergenic
932490563 2:72117367-72117389 GGGCCTGGTGGGAGGTGTTGGGG - Intergenic
933370854 2:81413550-81413572 GGGCCTGGTGGGAGACGTTTGGG - Intergenic
934517312 2:94996823-94996845 GAGGGTGCTGGGAGAGCTTCTGG + Intergenic
934526298 2:95053832-95053854 GGGGCGCTCGGGAGAGCTTGTGG - Exonic
934924752 2:98374488-98374510 GTGGCTGGTGGAAGGGCCTGGGG - Intronic
934998128 2:98985391-98985413 GGGGGTGGAGGGAGAGCATCAGG - Intergenic
935679077 2:105620459-105620481 CGGGCTGGGGGCAGAGCTTGTGG - Intergenic
935832744 2:107017458-107017480 GGGGCTGGTGGGGGGGCGAGTGG - Intergenic
937320289 2:120956792-120956814 TGGGCTGGTGGGAAATCATGTGG + Intronic
937321611 2:120964279-120964301 GGGGCTGGAAGGAGACCTGGTGG + Intronic
939091665 2:137787140-137787162 GGGCCTGGTGGGAGATGTTTTGG - Intergenic
939289168 2:140170936-140170958 GGGACTGGTGGGAGATGTTTTGG + Intergenic
939985966 2:148830150-148830172 GGGGCTGGTGGGAGGTGTTTGGG + Intergenic
940042147 2:149371930-149371952 GGGGCAGGTGGAAGGGCTTAAGG - Intronic
940590130 2:155713176-155713198 GGGGTTGTTGGGAAAGGTTGAGG - Intergenic
940992068 2:160107615-160107637 GAGGCTGGTGGAAGAGATTGAGG - Intronic
941843176 2:170109350-170109372 GTGACTGCTGGGAGACCTTGGGG - Intergenic
944454372 2:199878189-199878211 GGAGCTGGTGTGAGTGCTTTTGG + Intergenic
944645835 2:201780629-201780651 GGGGCAAGTGGGAGAACCTGGGG + Intronic
945004209 2:205386287-205386309 GGGGTTGGGAGGAGAGCCTGTGG + Intronic
945094871 2:206209532-206209554 GGGGCATGTGGGAGGGCTAGGGG - Intronic
945891667 2:215436463-215436485 GGGGGTGGTGGTAGTGTTTGAGG + Intergenic
946070872 2:217033421-217033443 GGGGCCGGAGGGACCGCTTGGGG + Intergenic
947287538 2:228533166-228533188 GGGCCTTGTGGGAGTGTTTGGGG + Intergenic
948260903 2:236603898-236603920 GGGGCTGGAGGGGGAGCTTGAGG - Intergenic
948363981 2:237442741-237442763 GGGGCTGCTGGCAGAGCATGTGG + Intergenic
948385119 2:237576178-237576200 GTGGATGGTGCGAGAGCTGGGGG - Intronic
948429564 2:237911210-237911232 GGAGCTGGTGGCAGAGGTTCGGG + Intronic
948748060 2:240110071-240110093 GGGGCTGGAGGGAGGGCAGGAGG + Intergenic
948845619 2:240681574-240681596 GGGGCTGCAGGGAGAGCCAGGGG - Intronic
948848236 2:240693156-240693178 GGGGCTGCAGGGAGAGCCAGGGG + Intronic
948921552 2:241068295-241068317 GGGACTCCTGGGAGAGCTCGGGG - Intronic
948921569 2:241068367-241068389 GGGACTCCTGGGAGAGCTCGGGG - Intronic
949039961 2:241843726-241843748 GGGGCTGGTGGGGCCGCATGGGG - Intergenic
949048907 2:241886521-241886543 GGGGCAGGTGGCAGACCTCGGGG + Intergenic
1168835665 20:875739-875761 GGGCCTGGTTGGAGAGAATGCGG + Intronic
1168877317 20:1180691-1180713 GGTGCTGGAGGGAGAGCTCGGGG - Exonic
1168897801 20:1335889-1335911 GGGGAGGGTGGGAGAGGTTGAGG + Intronic
1168919407 20:1518524-1518546 GGGGGTGCTGGGAGAGGTTGGGG + Intergenic
1169028710 20:2391500-2391522 GGGGGTGGGGGGTGAGCTGGAGG + Intronic
1169414240 20:5402458-5402480 GGGCCTGGTGGGAGGTCTTTGGG - Intergenic
1171123357 20:22583481-22583503 TATGCTGGTGGGAGAGTTTGGGG - Intronic
1171146470 20:22788190-22788212 GGGGCTGCTGGGAGAGACTGAGG - Intergenic
1171887679 20:30671214-30671236 GGGGCTGGTGGGAGATTCTCTGG - Intergenic
1171961526 20:31498245-31498267 GGGGCTGCTGTGAGAGCCTCGGG - Intergenic
1172091675 20:32437082-32437104 GGGAAAGGTGGGAGAGCTAGAGG - Exonic
1172448122 20:35003644-35003666 GGGGCTGGTGGGAGCCCCAGTGG + Intronic
1172706986 20:36889178-36889200 GATGCTGGTGGCAGAGCCTGGGG + Intronic
1173336179 20:42113922-42113944 GGGGTTGGAGGGGGAGCTTCCGG + Intronic
1173645646 20:44631620-44631642 GGGGCTGGAGGGAGACCATTAGG - Intronic
1173752337 20:45487349-45487371 GGAGCGGGTGGGAGAGGCTGAGG - Intergenic
1173923133 20:46760830-46760852 GGGGCTGGGGGGTGAGTGTGTGG - Intergenic
1173950208 20:46986845-46986867 GGGGCTAGTGGGAGAGGTTTGGG - Intronic
1174350446 20:49963776-49963798 GAGGCAGGAGGGATAGCTTGAGG + Intergenic
1174597030 20:51692485-51692507 GGGGCTGGAGGGGGAGCGTGGGG + Intronic
1175113660 20:56666500-56666522 GGGGCTGCTGGAAGGGCTTCTGG - Intergenic
1175131692 20:56794307-56794329 TGGGATGGTGGGAGAGGTGGTGG - Intergenic
1175238009 20:57526391-57526413 GGGGGCGCTGGGAGACCTTGGGG + Intergenic
1175366806 20:58461432-58461454 GCGGCTGGTGGGTCAGCTCGGGG - Exonic
1175596631 20:60239762-60239784 GGGTCTGGAGGGAAAGCCTGAGG + Intergenic
1175851814 20:62097771-62097793 GGTGCAGGTGGGAGAGGGTGTGG + Intergenic
1175999238 20:62824734-62824756 TGGGCTGGGGTGGGAGCTTGAGG - Intronic
1176097045 20:63349071-63349093 GGGACAGGTGGGAGAGCCAGGGG - Intronic
1176157171 20:63627602-63627624 GGGACTGGGGTGACAGCTTGAGG - Intergenic
1176285082 21:5015225-5015247 GGGGCAGCTGGGAGAGGCTGTGG - Intergenic
1176304031 21:5114155-5114177 GGGAGTGGTGGGGGAGCTGGGGG + Intergenic
1176304044 21:5114195-5114217 GGGAGTGGTGGGGGAGCTGGGGG + Intergenic
1176304069 21:5114275-5114297 GGGAGTGGTGGGGGAGCTGGGGG + Intergenic
1176304082 21:5114315-5114337 GGGAGTGGTGGGGGAGCTGGGGG + Intergenic
1176304106 21:5114395-5114417 GGGAATGGTGGGGGAGCTGGGGG + Intergenic
1177524489 21:22274138-22274160 AGGACTGATGGGAGAGCCTGTGG + Intergenic
1178205106 21:30455914-30455936 GGGCCTGGTGGGAGGTGTTGAGG - Intergenic
1178205246 21:30456873-30456895 GGGCCTTGTGGGAGATGTTGGGG - Intergenic
1178255956 21:31052855-31052877 GCTTCTGGTGGGAGAGCTGGAGG - Intergenic
1178660741 21:34505517-34505539 GAGGCTGGAGGGAGAGTGTGAGG + Intergenic
1178758749 21:35379759-35379781 TGCGCTGGGAGGAGAGCTTGAGG - Intronic
1178802368 21:35808002-35808024 GGGCCTGGTGGGAGGGGTTTGGG - Intronic
1178851958 21:36219931-36219953 GGGGGTGTTGGGGGAGATTGGGG + Intronic
1179081888 21:38179009-38179031 GGGGGTGGTAGTAGAGATTGTGG - Intronic
1179427152 21:41290600-41290622 GGGGCGGGGCGGAGAGCGTGGGG - Intergenic
1179638894 21:42733902-42733924 GGGGCTGGTGGGAGGTGTTTGGG + Intronic
1179852950 21:44147635-44147657 GGGAATGGTGGGGGAGCTGGGGG - Intergenic
1179852987 21:44147755-44147777 GGGAGTGGTGGGGGAGCTGGGGG - Intergenic
1179872099 21:44248250-44248272 GGGGCAGCTGGGAGAGGCTGTGG + Intronic
1179880998 21:44293301-44293323 GGGGCTGTGGGGGGAGCGTGGGG + Intronic
1180245834 21:46546685-46546707 GGGGCTGGTGGGGCAGCATCAGG - Intronic
1181629171 22:24141567-24141589 AGGGCTGGTGGGAGGGCATCTGG - Intronic
1181846251 22:25711776-25711798 GGGGCAGGGGGTAGAGCCTGGGG - Intronic
1182059480 22:27386794-27386816 GGGGCAGGTGGCAGAGAATGAGG - Intergenic
1182420051 22:30244638-30244660 GGGGCTGGAAGGAGAGAATGGGG - Intronic
1182443762 22:30378713-30378735 GGTGGTAGTGGGAGACCTTGGGG + Intronic
1182524329 22:30906157-30906179 TGGGCTGGTGGGTGGGCTTGTGG - Intronic
1182602345 22:31475948-31475970 GGGGCTGGGGGGAGGGGTTCAGG + Intronic
1183121214 22:35731571-35731593 GAGGCTGGAGAGAGAGCTGGAGG + Intergenic
1183726606 22:39593385-39593407 AGGGCAGGTGGGAGTGCTTCTGG + Intronic
1183956332 22:41382398-41382420 GGGTCTGGCGGGAGAGGGTGGGG + Intronic
1184038215 22:41928539-41928561 GGGGCTGGGGAGGGAGCCTGGGG + Intergenic
1184095633 22:42314851-42314873 GGGGCTGGAGGGAGGGGTTCTGG - Intronic
1184252138 22:43266838-43266860 GGGGCTGCTCCGAGAGCTTCAGG - Intronic
1184444225 22:44537863-44537885 GGGGCTGGCAGGGGAGCCTGTGG + Intergenic
1185066263 22:48633101-48633123 CGGGCTGCTGGGAGACCCTGTGG - Intronic
949570256 3:5285544-5285566 GGGGCTGATGGTAGGGGTTGGGG + Intergenic
949852133 3:8430080-8430102 GGGGCTGGGCCTAGAGCTTGGGG - Intergenic
950138558 3:10600104-10600126 GGGGCTGGTGGGGGGCCATGGGG + Intronic
950434008 3:12967751-12967773 GGGGCCGGAGGGCGAGCTGGGGG + Intronic
950434019 3:12967775-12967797 GGGGCCGGAGGGCGAGCTGGGGG + Intronic
950466503 3:13158527-13158549 GGGGATGGTGGGGGAGATTCTGG - Intergenic
950552575 3:13675573-13675595 GAGGCTGCTGGCAGAGCTGGAGG - Intergenic
950866075 3:16190309-16190331 TGGGCTGGAGGGGGAGCCTGAGG - Intronic
951796836 3:26548666-26548688 GGGGATGGAGGCTGAGCTTGGGG - Intergenic
952010662 3:28897284-28897306 GGGCCTGGTGGGAGATGTTTTGG - Intergenic
952546079 3:34420839-34420861 GGGCCTGGTGGGAGATGTTTGGG + Intergenic
952851427 3:37732836-37732858 GTGGCTGGTGGAAGGGCTGGGGG - Intronic
952918037 3:38264329-38264351 GATCCTGGTGGGAGAGGTTGGGG + Intergenic
953495989 3:43387403-43387425 TGGGCGGCAGGGAGAGCTTGAGG + Intronic
953608700 3:44429264-44429286 GGGGCTGGTGGGAGTGGCTTGGG - Intergenic
954141840 3:48611257-48611279 GGGTGTGGTGTGAGAGCCTGTGG - Intergenic
954419890 3:50413178-50413200 GGGGGTGGTGGTGGAGCATGAGG + Intronic
954636128 3:52071785-52071807 GGGGATGGTGGGGGGGCTCGTGG - Intergenic
954807105 3:53226942-53226964 GGGCCTGGTGGGACATCCTGAGG + Intronic
955073087 3:55588259-55588281 GGGGCTGGAAGGAGGGGTTGGGG - Intronic
955081125 3:55658827-55658849 TGGGCTTGGGGAAGAGCTTGTGG - Intronic
955167130 3:56525837-56525859 GGGCCTGGTGGGAGATGTTTGGG + Intergenic
956004456 3:64763572-64763594 GGGCCTGGTGGGAGGGGTTTGGG - Intergenic
956862602 3:73339428-73339450 GGGGTTGGGGGGTGAGCATGAGG - Intergenic
957048602 3:75395202-75395224 AGGCCTGGTGGGCTAGCTTGGGG - Intergenic
958038750 3:88200872-88200894 GGGCCTGGTGGGAGATATTTGGG - Intergenic
959295305 3:104528120-104528142 GGGGCAGGAGGGATAGCTTTAGG - Intergenic
959341071 3:105132177-105132199 GGGCCTGGTGTGATAGCTTTTGG - Intergenic
959383990 3:105678526-105678548 GGGGGAGGTGGGAGAGATGGAGG + Exonic
960516037 3:118603906-118603928 GGGGCTGGTGGGAGGTGTTAAGG + Intergenic
960652149 3:119962794-119962816 GGGGCTGGTGGGAAGGTTTCAGG + Intronic
960993231 3:123325124-123325146 GGGGTGGTGGGGAGAGCTTGGGG + Intronic
960993264 3:123325295-123325317 GTGGCTGGTGGGGCAGCCTGTGG - Intronic
960999948 3:123367524-123367546 GCTGAGGGTGGGAGAGCTTGGGG - Intronic
961469770 3:127104296-127104318 GGGGCTGGGAGGAGGGCATGGGG - Intergenic
961544933 3:127626505-127626527 CGGGCTGGGTGGATAGCTTGAGG - Intergenic
961660692 3:128467412-128467434 GGGGCTGGTGGCAGTGGTAGAGG + Intergenic
961965214 3:130894483-130894505 GGGGCGGGTGCGGGATCTTGGGG + Intronic
962440718 3:135413515-135413537 GGGCCTGGTGGGAGATGTTTGGG + Intergenic
962555916 3:136551361-136551383 GTGGGAGGTGGGAGAGGTTGAGG - Intronic
963061455 3:141230418-141230440 GGGCCAGGTGGGAGAGTTGGGGG + Intronic
963817223 3:149844952-149844974 GGGCGTGGGGGGAAAGCTTGAGG - Intronic
964138373 3:153370020-153370042 AGGGCTGGTGGCAGTGCTGGCGG + Intergenic
964238129 3:154558481-154558503 GGGGCAGGAGGGAGAGCATCAGG - Intergenic
964458327 3:156893489-156893511 GGGCCTGGTGGGAGATATTTAGG + Intronic
966250828 3:177863513-177863535 GGGTCTGGTGGTAGACTTTGAGG + Intergenic
966728875 3:183133676-183133698 GGGGCTGCTCAGATAGCTTGGGG + Intronic
967299666 3:188000570-188000592 GGGGCAGGTGGGGGTGTTTGGGG + Intergenic
967344507 3:188439295-188439317 GGGACTGGTTGGTGAGATTGAGG - Intronic
968067211 3:195765226-195765248 GAGGGTGGTGGGTGGGCTTGTGG + Intronic
968716710 4:2165411-2165433 GGGGCTGGTGGGAGGGAGGGAGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968969167 4:3784510-3784532 GGGCTTGGTGGGGGAGCTGGGGG + Intergenic
969172761 4:5377035-5377057 GTGGCTGTGGGGAGAGCTGGGGG - Intronic
969317535 4:6391063-6391085 GGGGCTGGTGGGAGTATTTTTGG + Intronic
969442186 4:7224032-7224054 GGGGCTGCTGAGTGAGCTGGGGG + Intronic
969843566 4:9901666-9901688 GGGGCTGGTGGGGGGGCATGGGG - Intronic
970107500 4:12601467-12601489 GGGGGTTGTGGGAGAGCATTAGG + Intergenic
970538561 4:17054986-17055008 GGGCATGATGGGAGAGGTTGAGG - Intergenic
970613060 4:17743260-17743282 GGGGGTGGGGAGAGAGCTCGTGG + Intronic
970665585 4:18333038-18333060 GGGCCTGGTGGGAGAGGTTTGGG - Intergenic
970934188 4:21549337-21549359 GGGCCTGGTGGGAGGGGTTTTGG + Intronic
971005526 4:22370313-22370335 GGGGCTGGGGTGAGGGCTTTTGG - Intronic
972299832 4:37774176-37774198 GGGCCTGGTGGGAGGTGTTGGGG - Intergenic
973665182 4:53152032-53152054 GGGCCTGGTGGGAGATGTTTGGG - Intronic
974372981 4:61041825-61041847 GGGGCTGGTAGGAGATGTTTGGG - Intergenic
976101685 4:81571038-81571060 GGGGCTGGTGTGAGGGCTTTGGG - Intronic
976462613 4:85330194-85330216 TGGGGTGGTGAGAGAGGTTGAGG + Intergenic
977619652 4:99121807-99121829 GGGGCAGGAGGGAGAGCATCAGG - Intergenic
977685840 4:99846933-99846955 GGGGTTGGTGGGAGAGAATAGGG - Intronic
978205948 4:106081509-106081531 GGGCCTGTTGGGGGAGCTGGGGG + Intronic
978653732 4:111041058-111041080 GGGGAGGGAGGGAGAGCCTGAGG + Intergenic
978947317 4:114515640-114515662 GGGGCTGGTGGGAAATCTGGAGG - Intergenic
980035767 4:127881190-127881212 GGGGCGGGTGGGAGTAATTGTGG + Intronic
980665552 4:135929153-135929175 GGGGCGTGTGGGAGAGCATTAGG - Intergenic
980929985 4:139176449-139176471 GGGGCTGGGCGGCGAGCTCGGGG - Intronic
981825473 4:148935782-148935804 GGGCCTGGTGGGAGGAGTTGTGG + Intergenic
982015322 4:151147692-151147714 GAGGCTGGTGGATCAGCTTGAGG - Intronic
982474877 4:155837919-155837941 GAGGCTGGAGGGAGAGCTTGGGG - Intronic
982482079 4:155923942-155923964 GGGGGTGGTGGGAGAAGTTAGGG + Intergenic
982598197 4:157412707-157412729 GGGGCTGGTGGGAGGTGTTTTGG - Intergenic
984042835 4:174757878-174757900 GGGCCTGGTGGGAGATGTTTGGG + Intronic
984782489 4:183538561-183538583 GGGCCTGGTGGGAGATGTTTGGG - Intergenic
984913656 4:184700111-184700133 AGGGCTGTTGTGAGAGCTAGAGG - Intronic
985124693 4:186681741-186681763 GGGGCTGGAGGGAAAGTTTGTGG - Intronic
985309095 4:188577685-188577707 GGGCCTGGTGGGAGGGGTTTGGG - Intergenic
985357086 4:189132911-189132933 GGGGCTGGTGGGAGGTGTTTGGG + Intergenic
985522510 5:383794-383816 GGGGGTGGGAGGACAGCTTGAGG - Intronic
986136449 5:4984020-4984042 GGGGCTGCTGGGGGAACATGAGG - Intergenic
986304888 5:6507621-6507643 GGGCCTGGTGGGAGGGGTTTGGG + Intergenic
986330384 5:6713182-6713204 GGGGCTGGAGGGAGAGGCGGTGG - Intergenic
986457295 5:7932053-7932075 GGAGCTGGGGTGAGAGCTTTGGG - Intergenic
986506293 5:8455627-8455649 GGGGCTGGTGGGAGGTGTTTGGG + Intergenic
986642255 5:9883698-9883720 GGGTCTGCTGGGAGATCTTCTGG + Intergenic
987156823 5:15096894-15096916 GGGGCTGCGGGGGGTGCTTGCGG - Intergenic
987187964 5:15444536-15444558 GGGCCTGGTGGGAGGACTTTGGG + Intergenic
988121158 5:26964760-26964782 GGGGCAGGTGGGATAGCATTAGG - Intronic
988608844 5:32706030-32706052 GGGCCTGGTGGGAGATGTTTGGG + Intronic
988993455 5:36693027-36693049 GGGGCCGCTGGGAGAGCCCGCGG - Intergenic
991102216 5:62805188-62805210 GGGCCTGGTGGGAGATGTTTGGG + Intergenic
992200108 5:74374832-74374854 GGGGTTAGTGGGAGAGGATGCGG - Intergenic
992832836 5:80611784-80611806 GGGCCTGGTGGGAGATTTTTGGG - Intergenic
993340774 5:86722750-86722772 GGGGCTGGTGGGAGGTGTTTGGG - Intergenic
993966991 5:94371041-94371063 GGAGCTGGTGGGGGAGCGGGTGG + Intronic
995911489 5:117193081-117193103 GGGCCTGGTGGGAGATATTTGGG + Intergenic
997343354 5:133164948-133164970 GGGGCTGGAGGGAGTGCTAACGG - Intergenic
997447084 5:133948394-133948416 GGGCCTGGTGGGAGATGTTTGGG - Intergenic
997585345 5:135040135-135040157 GGGGCTGGTGGTCGAGTTTGGGG + Intronic
997715231 5:136037577-136037599 AGGGCTGGTGGAGGAGCTAGCGG + Intronic
997743306 5:136276866-136276888 GGGAGTGGTGGGTGAGCATGGGG + Intronic
998018417 5:138751259-138751281 GGGGCTGGTGGGAGGCATTTGGG - Intronic
998177590 5:139911429-139911451 GGGGCTGGGAGAAGAGCTGGTGG - Intronic
998329030 5:141307040-141307062 GGGGAGGGTGGGAGGGATTGAGG + Intergenic
998524196 5:142827475-142827497 GGTGCTGGTGGTGGAGGTTGAGG + Intronic
999443544 5:151621023-151621045 GGGGGTGGTGGAGGAGGTTGGGG + Intergenic
999900217 5:156079261-156079283 GGGCCTGGTGGGAGGGATTTGGG - Intronic
1000910766 5:167019357-167019379 TGGGCTGGTAGGAGTGGTTGTGG + Intergenic
1001161068 5:169314273-169314295 GGGGATGGTGGGACAGATAGTGG + Intergenic
1001179241 5:169503246-169503268 GGGGCTGGGGGGAGAGAAAGGGG - Intergenic
1001441948 5:171750247-171750269 GGGGATGATGGGAGTGCTGGTGG - Intergenic
1001913594 5:175541217-175541239 GGGCCCTGTGGGACAGCTTGGGG - Intergenic
1001933844 5:175691064-175691086 GGCCCTGGGTGGAGAGCTTGAGG + Intergenic
1002467660 5:179415892-179415914 GGGGCTGGTGTGGGAACTTCTGG - Intergenic
1002812076 6:640272-640294 AGGGGTGCGGGGAGAGCTTGAGG + Intronic
1003508415 6:6759150-6759172 GGGGCTGGTGGGAACACTAGAGG + Intergenic
1004080394 6:12386767-12386789 GGGGGTGGTGGGGGAGGGTGAGG + Intergenic
1004236242 6:13877199-13877221 GGGACTGGTGGGAGATGTTTGGG - Intergenic
1004878115 6:19976699-19976721 CGGGGTGGGGGGAGAGCTTGAGG + Intergenic
1005117682 6:22356449-22356471 GGGGCTGGTGGGGGAGGCTTGGG + Intergenic
1006131162 6:31870335-31870357 GGGGTTGGTGGGAGTGGTGGTGG - Intronic
1006174870 6:32115759-32115781 GGGGCTGGTGGGAGGCCTGGTGG + Exonic
1006187428 6:32189341-32189363 GGGGCTGGGTGGAGAGTTAGGGG + Intronic
1006440961 6:34053406-34053428 GGGGCTGCTGGGAATGTTTGTGG - Intronic
1006985483 6:38172954-38172976 TGGGCTGGTGGGGGTGCTGGAGG - Exonic
1007103773 6:39269292-39269314 GGGCCTGGTCAGAGGGCTTGAGG - Intergenic
1007279320 6:40698764-40698786 TGGACTGATGGGAGAGCCTGTGG + Intergenic
1007341211 6:41192557-41192579 GGGGCTGGTGGAGGAGCATCGGG - Intronic
1007577915 6:42938095-42938117 TGTGCTGGTGGAAGAGTTTGAGG + Exonic
1007809209 6:44474357-44474379 AGGGCTGGTGGCAGATCCTGGGG + Intergenic
1008030427 6:46688227-46688249 GGGGCTGGTGGGCGAGCGGCGGG + Exonic
1008109706 6:47478428-47478450 GAAACTGGTGGGAGAGCTCGCGG + Intronic
1008629217 6:53348120-53348142 GAGGCTGGTGGGAAAGCGAGAGG - Intronic
1009442968 6:63704404-63704426 GGGGCTGGTGGGGGTGTTGGGGG - Intronic
1010289173 6:74115576-74115598 AGGGCTGGTGGGAGGGGTGGAGG + Intergenic
1011178101 6:84587454-84587476 GGGGCTGCTAGCAGTGCTTGTGG + Intergenic
1011474478 6:87737454-87737476 GGGGCAGGTGGGAGAGTGAGGGG - Intergenic
1012295718 6:97520115-97520137 GAGGCTGGTGAGAGTGGTTGGGG + Intergenic
1013013070 6:106136873-106136895 GGTGATGGTGGGAGAGCTGCGGG - Intergenic
1013224971 6:108114180-108114202 CTGGCTGGTGGGACAGCTGGAGG - Intronic
1015047921 6:128800134-128800156 GGGGCTGGTGGGGTGGGTTGGGG + Intergenic
1015868773 6:137754379-137754401 GGGAGTGAGGGGAGAGCTTGTGG - Intergenic
1016423212 6:143906914-143906936 GGGGAAGGAGGGAGAGCATGAGG - Intronic
1016950717 6:149577088-149577110 GGGCCTGGTGGGAGATGTTTGGG - Intronic
1017003905 6:150015539-150015561 GGGGCTCTTGGCAGCGCTTGGGG + Intergenic
1017291662 6:152744837-152744859 GGAGCTGGGGGGAGAGCCTGTGG + Intergenic
1017454948 6:154593265-154593287 GGTGCTGGGGAGAGAGCTGGGGG - Intergenic
1017458319 6:154623693-154623715 GGGCCTGGTGGGAGATGTTTGGG - Intergenic
1017911179 6:158794291-158794313 GGTGCTGGTGGTAGTGCTGGTGG - Intronic
1018767659 6:166946360-166946382 GGGGCTGGCGGGCGAGCGTCAGG + Intronic
1018805071 6:167252867-167252889 GGGCCTGGTGGGAGATGTTTGGG + Intergenic
1018840684 6:167514303-167514325 GGGGGTGCTGGGGGAGCTGGGGG + Intergenic
1018971969 6:168536260-168536282 GGGGCCAGTGGGGGAGCCTGTGG + Intronic
1019018695 6:168900021-168900043 TGGGCTGGAGGGAGAACTTTTGG + Intergenic
1019361920 7:609066-609088 AGGGCTGTAGGGAGAGCTGGGGG + Intronic
1019480563 7:1264810-1264832 GGGGCTGCTGGGAGAGTTCCAGG - Intergenic
1019543668 7:1562520-1562542 GGGGGTGGTGGGGAGGCTTGGGG + Intergenic
1019566851 7:1687136-1687158 GGGGGAGATGGGAGAGCTTCAGG + Intergenic
1019574005 7:1727517-1727539 GGGGCTGGGGAGACAGCTTGGGG - Intronic
1019614901 7:1954813-1954835 GGTGGGGGTGGGAGAGCTCGGGG - Intronic
1019737084 7:2655991-2656013 TGGGCTGGAGGGAGACCTGGGGG + Intronic
1020104397 7:5415144-5415166 GGAGCTGGTGGGAGGGGATGTGG - Intronic
1021822457 7:24511719-24511741 GGGGCTGGTCTGAGAGATTGAGG - Intergenic
1022310754 7:29194328-29194350 GGGGCTGGAGGGGGAGGCTGCGG - Intronic
1022685036 7:32589265-32589287 GGAGCTGATGGGATAACTTGAGG + Intergenic
1023032471 7:36102578-36102600 GGGGCTGGTGGGTGAGGTAAAGG + Intergenic
1023089372 7:36603342-36603364 GGAGCTGGAGGAAGAGCTTGTGG - Intronic
1023223560 7:37945877-37945899 GGGCCTGTTGGTGGAGCTTGGGG - Intronic
1023883495 7:44334925-44334947 GGGGACGGTGGTAGAGCCTGAGG + Intergenic
1023956859 7:44893508-44893530 CAGGCTGGCAGGAGAGCTTGGGG + Intergenic
1026166990 7:67918976-67918998 GGGGCTAGTGGGAGATGTTTTGG - Intergenic
1026195526 7:68170199-68170221 CGGGCTGGTGGGAGACTTGGGGG + Intergenic
1026451267 7:70531705-70531727 GGGCCTGGTGGGAGGTGTTGGGG - Intronic
1026671248 7:72392457-72392479 GGTGCTGATGGGAGAGACTGAGG + Intronic
1026968024 7:74452955-74452977 GAGGCTGTGGGGAGACCTTGTGG + Intergenic
1028479073 7:91284801-91284823 GGGGCTGATGGGAGGGGTTTGGG - Intergenic
1029625667 7:101718821-101718843 GGGTCTGGTGGGAGTTCATGAGG + Intergenic
1029692380 7:102190879-102190901 GGGGCTGATGGGACAGCAGGAGG - Intronic
1031722757 7:125197350-125197372 AAGGCAGGTGGGATAGCTTGAGG - Intergenic
1032665360 7:134030681-134030703 GGGGCGGGGGGGTGAGCTGGGGG - Intronic
1032719148 7:134536673-134536695 GGGGCTGGTGAAAGCCCTTGGGG + Exonic
1032724118 7:134575443-134575465 GGGGCTGGTGAAAGCCCTTGGGG + Exonic
1033243325 7:139699168-139699190 CAGGCTGGTGGGAGAGATGGCGG - Intronic
1033757046 7:144403990-144404012 GGGGCTGGAGGGCGAGGCTGGGG + Intronic
1034505604 7:151487334-151487356 AGAGCTGGGGGGAGAGGTTGCGG + Intronic
1034883344 7:154778993-154779015 GGTGCTGGTGGTGGAGGTTGTGG - Intronic
1034883369 7:154779082-154779104 GGTGGTGGTGGTAGAGGTTGTGG - Intronic
1035006291 7:155663569-155663591 GGGCCTGGTGGGAGGCGTTGGGG - Intronic
1035026998 7:155832665-155832687 TGGGCTGGGAGGAGAGCTGGGGG + Intergenic
1035741742 8:1933554-1933576 GGGGCGGGTGGGGGGTCTTGAGG + Intronic
1036651130 8:10644719-10644741 GTGGCTGGTGTGAGAGCTGTGGG - Intronic
1036847817 8:12181669-12181691 GGGTCTGGTGGAAAAGCTAGTGG + Intergenic
1036869185 8:12423984-12424006 GGGTCTGGTGGAAAAGCTAGTGG + Intergenic
1037108756 8:15141237-15141259 GGGACTGGTGGTAGGGGTTGTGG + Intronic
1038278502 8:26141753-26141775 GGGCCTGGTGGGAGATATTTGGG + Intergenic
1038435405 8:27532201-27532223 GGGGCTGAGGGGAGAGGGTGAGG - Intronic
1038460661 8:27713887-27713909 GGGCCTGGTGGGAGCTGTTGGGG + Intergenic
1038643888 8:29348276-29348298 GGCGCTGGTGGGAGAGATGAGGG - Intronic
1039083713 8:33759186-33759208 GGGCCTGGTGGGAGGTGTTGGGG + Intergenic
1039888463 8:41668905-41668927 GGAGGTGGTGGCAGAGTTTGAGG - Intronic
1040029741 8:42813642-42813664 GGGCCTGGTGGGAGATATTTCGG + Intergenic
1040323945 8:46331829-46331851 GGGGCTGGTGGGTCAGCTGGCGG - Intergenic
1040484393 8:47856224-47856246 GGGGGTGGTGGTGGAGCTGGGGG + Intronic
1040680313 8:49801116-49801138 GGGCCTGGTGGGAGAGGTTTGGG + Intergenic
1040857242 8:51960885-51960907 GAGGATGGTGGGAAAGATTGGGG + Intergenic
1040871146 8:52101066-52101088 GGGGCAGGTGGAAGAGGCTGGGG + Intergenic
1041407835 8:57519763-57519785 GGGGCTGGTTGGAGAGATGTTGG - Intergenic
1042030804 8:64473348-64473370 GCGGCAGGCGAGAGAGCTTGTGG - Intergenic
1042327114 8:67540589-67540611 GGGGCGGCTGGCACAGCTTGAGG - Intronic
1042611619 8:70607669-70607691 GGGGCGGGTGGGCGGACTTGGGG - Intronic
1043384112 8:79731475-79731497 GGGCCTGGTGGGAGATGTTTGGG - Intergenic
1043643824 8:82491419-82491441 GGGCCTGGTGGGAGATGTTTGGG - Intergenic
1045457433 8:102395098-102395120 GAGGCTGGTGGGAGAGCTGTAGG - Intronic
1046546714 8:115661777-115661799 GGGGTTGGTGGGAGGTTTTGTGG - Intronic
1046948742 8:120000304-120000326 GGGGCTGGAGGGGGGCCTTGGGG - Intronic
1048103991 8:131387498-131387520 GGGGCTGTTCTGAGGGCTTGAGG + Intergenic
1048295859 8:133212858-133212880 GGGGCTGGAGAGAGGGCCTGCGG - Exonic
1049301630 8:141873754-141873776 GAGGCAGGTGAGAGTGCTTGTGG + Intergenic
1049382593 8:142324909-142324931 GGGGCTGTGGGAAGAGCCTGTGG + Intronic
1049399514 8:142418704-142418726 GGGGAGGGTGGGGGAGCCTGGGG - Intergenic
1049571835 8:143373196-143373218 GGGGATGGTGCGGGGGCTTGGGG + Intronic
1049653834 8:143789133-143789155 GGTGCTGGTGGGGGCGCTGGCGG + Intergenic
1049806294 8:144542160-144542182 GGAGCAGGTGGGAGAGCTGGAGG + Intronic
1049833970 8:144721170-144721192 GGGGTTGGTGGGAGAGGTGGTGG + Exonic
1051366715 9:16326576-16326598 AGGGCAGGTGGGAGAGGTGGGGG - Intergenic
1052952687 9:34226159-34226181 TGGGCTGGAGGGATTGCTTGAGG + Intronic
1053295045 9:36906691-36906713 GGGGCTGGTGGGAGAGCTTGCGG - Intronic
1053304227 9:36972646-36972668 GGGGGTGGTGGGAGTGCTGGGGG + Intronic
1053440549 9:38112773-38112795 GGGGATAGTGAGAGTGCTTGTGG + Intergenic
1056663540 9:88562318-88562340 GGGGCGGCTGGGAGTGCTGGAGG + Intronic
1057076906 9:92142599-92142621 GGAGCAGGTGGGAAAGCCTGGGG + Intergenic
1057195808 9:93115268-93115290 AGGGGTTGTGGGAGAGCTGGAGG + Intergenic
1057397053 9:94689665-94689687 GGGGCTGGTGGGAAGGCGGGAGG - Intergenic
1057709034 9:97420369-97420391 GGGGCGGGTGGGGGAGGGTGTGG + Intronic
1059419660 9:114183149-114183171 GTGCCTGGTGGGAGGGCTTCAGG + Intronic
1059512664 9:114864205-114864227 GGAGTTGGAGGTAGAGCTTGCGG - Intergenic
1059570643 9:115430824-115430846 GTGGCAGGTGGGAGACATTGGGG - Intergenic
1060243689 9:121926323-121926345 GGACCTGGAGGGAGAGCGTGTGG - Intronic
1061089261 9:128417682-128417704 GGGGAGGGTGGGAGGACTTGGGG + Intronic
1061293936 9:129666960-129666982 GGGGCGGGTGGGAGGGCTGCTGG - Intronic
1061612364 9:131755664-131755686 GGGGCTGGTGGGTGAGGAAGAGG - Intergenic
1062101681 9:134731701-134731723 GGGGCTGGTGGGGCATCATGGGG + Intronic
1062367513 9:136218310-136218332 GGGGCTGGGGGGAGAGAGAGAGG - Intronic
1062476888 9:136732741-136732763 GGGGTGGGGGGGAGAGCTTGGGG - Intergenic
1203767965 EBV:36390-36412 GGGGGTGGTGGGAGTGGTGGGGG - Intergenic
1185578274 X:1190971-1190993 GGGGCTGGTGGGGAAGCTGGAGG + Exonic
1185895537 X:3855129-3855151 GGGGAAGGTGGGAGAGGATGAGG - Intergenic
1185900656 X:3893553-3893575 GGGGAAGGTGGGAGAGGATGAGG - Intergenic
1185905772 X:3931984-3932006 GGGGAAGGTGGGAGAGGATGAGG - Intergenic
1185913961 X:4014191-4014213 GGGCCTGGTGGGAGACGTTTGGG + Intergenic
1186185172 X:7013727-7013749 GGGGCTGGAGTGAGTGCTTTGGG + Intergenic
1186554311 X:10541333-10541355 GGGGGTGGTGGGAGGGCAGGGGG - Intronic
1186607585 X:11108361-11108383 GGGTATGGTGGGAGGGTTTGTGG - Intergenic
1187633527 X:21201743-21201765 GGGCCTGGTGGGAGATATTTGGG - Intergenic
1188585820 X:31773989-31774011 GGTGATGGTGGGTGACCTTGAGG - Exonic
1189322319 X:40094478-40094500 CGGGCTGGTGGGAGCGCGGGGGG - Intronic
1189371435 X:40432392-40432414 GGGGCTGGTCTGAGAGCTGATGG + Intergenic
1190887381 X:54541638-54541660 GGGGCTGGTGGCGGAGTTGGGGG + Intronic
1192192479 X:68999905-68999927 AGGGCTGGTGGGGAGGCTTGGGG - Intergenic
1192220981 X:69197197-69197219 GTGGCTGGCGGGGGAGCTGGGGG - Intergenic
1192913638 X:75632187-75632209 TAGGCTGTTGGGAGATCTTGGGG + Intergenic
1193137582 X:77989683-77989705 TGAGCTGGAGGGAGAGTTTGAGG - Exonic
1196196053 X:112839912-112839934 GGTGGTGGTGGTAGTGCTTGTGG - Intronic
1196278886 X:113799622-113799644 GGGCCTGGTGGGAGGTGTTGGGG + Intergenic
1197013346 X:121593919-121593941 GGAGCTGGGGTGAGAGCTTTAGG + Intergenic
1198189727 X:134289918-134289940 GGACCTGGTGGGAGAGGTTTGGG - Intergenic
1198382567 X:136098391-136098413 GGAGAAGGCGGGAGAGCTTGCGG - Intergenic
1198458160 X:136837827-136837849 GGGGCTGATGGGAGGGCTTGGGG + Intergenic
1199881544 X:151977352-151977374 GGGGTAGGCGGGAGAGTTTGCGG + Intergenic
1199982696 X:152929477-152929499 GTGGTGGGTGGGAGTGCTTGGGG + Intronic
1200745065 Y:6896953-6896975 GGGGCTGGATGGGAAGCTTGTGG + Intergenic
1200829455 Y:7676968-7676990 GGGGCTGGTGGCAGGGCCCGAGG - Intergenic
1201176013 Y:11308526-11308548 GGGGCTGGTGGGTGGGGGTGGGG - Intergenic
1201736178 Y:17264382-17264404 GAGGCTGGAGGGATAGCTTTAGG + Intergenic