ID: 1053296424

View in Genome Browser
Species Human (GRCh38)
Location 9:36917451-36917473
Sequence GGGGATTCCCTTACAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 2, 2: 0, 3: 4, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053296424 Original CRISPR GGGGATTCCCTTACAAAAAC TGG (reversed) Intronic
900941966 1:5804701-5804723 GGTGATTCTCTTACAAGGACTGG - Intergenic
906908319 1:49919262-49919284 GGGGATTCAATTAGGAAAACAGG + Intronic
916634270 1:166651534-166651556 GGGGATTCTCCTACAAATAGTGG - Intergenic
917002215 1:170372797-170372819 GGGCATTCAATTACAAAAAGAGG - Intergenic
923270976 1:232354725-232354747 GAGGATTCCCCTACTAAGACAGG - Intergenic
1064688110 10:17885365-17885387 GAGGAGTCCATTACACAAACTGG + Exonic
1066514741 10:36145418-36145440 GTGGATTCCCTGACAGAAATGGG + Intergenic
1081585099 11:44378813-44378835 GGGGATACCCTTTCAACCACTGG - Intergenic
1083858602 11:65406634-65406656 GGGTATTCCTTTTTAAAAACAGG - Intronic
1089118399 11:116114321-116114343 GGGGGTGCCCTGACCAAAACTGG - Intergenic
1092295488 12:7194589-7194611 GGGGATTCCATTACAAAATAAGG - Intronic
1099865121 12:88270221-88270243 GGGGAAACCCTTATAAAACCAGG - Intergenic
1101717307 12:107321705-107321727 GGGGATTCACCTGCAAAACCTGG + Intronic
1117867433 14:60164773-60164795 GGAGTTTCCCTTACAAACGCAGG + Intronic
1120080446 14:80210542-80210564 GAGGCTTCCCTTACAAATGCTGG + Intronic
1120511145 14:85415892-85415914 GCAGATTCACTTATAAAAACTGG + Intergenic
1126554889 15:49975350-49975372 GGGGGATCCCTTACATAAAATGG + Intronic
1130994392 15:88895780-88895802 GGGGATCCCCTTAGAAAGCCTGG + Intergenic
1131514502 15:93068024-93068046 GGGGAGTCCCTAACAGATACAGG + Intronic
1134099868 16:11444457-11444479 AGGGCTTCACTTGCAAAAACAGG - Intronic
1134250976 16:12573676-12573698 GAGGATGCCCTTGCAAAAATTGG + Exonic
1134466184 16:14479984-14480006 GGGGATTCACTAACAATAAACGG + Intronic
1135747522 16:25029858-25029880 GGGGATACCCTTAAAACACCTGG - Intergenic
1139303584 16:65964781-65964803 GGGAAGTCCCTTACAAAATCTGG - Intergenic
1139551011 16:67673102-67673124 GGGGATTCCCTCAGAGGAACCGG + Intergenic
1140178872 16:72693986-72694008 GGGTATTCAATTACAAAAAGAGG - Intergenic
1146515561 17:33486561-33486583 GGGGATTCCCCTACAGGGACAGG + Intronic
1155347966 18:24877396-24877418 GGGCATTGCCTTACAAACAAAGG - Intergenic
1155368203 18:25070562-25070584 GGGGCTTGCCTTACACAAGCAGG + Intronic
1156392025 18:36659793-36659815 GGGGCTTCCCTTTCAGAACCTGG - Intronic
1157866204 18:51187170-51187192 GGGTATTTCCTTACATAATCTGG + Intronic
1161819096 19:6518150-6518172 TGGGATTCCCTTTCCAAAGCGGG + Intergenic
1164507185 19:28870073-28870095 GGGGTTCCCCTCACAGAAACTGG - Intergenic
1167804006 19:51766594-51766616 GGGGAATCCCTTTCAAAGGCAGG + Intronic
933687307 2:85152970-85152992 GAGCATGCCCTTTCAAAAACAGG - Intronic
938789907 2:134667363-134667385 AGGGATTCCCTTACAGAGAGAGG + Intronic
939256228 2:139747593-139747615 GGGTATTCAATTCCAAAAACAGG - Intergenic
939580235 2:143937911-143937933 GGGGAACCTCTTACAAAAAAGGG + Intergenic
940576864 2:155519244-155519266 AGGCATTCCCTGTCAAAAACGGG - Intergenic
943140107 2:183971568-183971590 GGGCATTCAATTAGAAAAACAGG - Intergenic
944514628 2:200500308-200500330 GGGTATTCAGTTACAAAAAGAGG + Intronic
945715737 2:213355828-213355850 GGGGATTCGATTAGAAAAAGAGG - Intronic
1168811725 20:709236-709258 GGGGATTGTCTTACAAATAGGGG - Intergenic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1179817157 21:43913973-43913995 TGGGTTTTCCTTACAAAAGCTGG - Intronic
1183710569 22:39501149-39501171 GGGGAGGCCCTTACCAGAACTGG - Intronic
949205135 3:1428995-1429017 GGTGAGTCCCTTTAAAAAACTGG - Intergenic
950962661 3:17121927-17121949 GGGGCTTTCCTTAAAAAATCTGG - Intergenic
951989750 3:28663531-28663553 AGGAATTCTCTTACAAGAACAGG + Intergenic
956309027 3:67858747-67858769 GTGGACTCCCTTGCACAAACTGG - Intergenic
961095682 3:124154288-124154310 GGGTATTCAATTACAAAAACAGG + Intronic
968537541 4:1144055-1144077 TGGTATTCCCTAACAAAAAAAGG - Intergenic
969069837 4:4527304-4527326 GGGAATTCACTCACAAAAAAAGG + Intronic
969567509 4:7987476-7987498 GGGGGTTCCCTGACCAGAACAGG - Intronic
971417890 4:26450422-26450444 TGGGCTTCCCTTGCAAAAGCAGG - Intergenic
973100253 4:46258788-46258810 GGGGATTCCTTGAGAAAAATAGG + Intronic
975548804 4:75588946-75588968 GGGGATCCCACTAGAAAAACTGG + Intronic
977457734 4:97282769-97282791 GGGTATTCAATTACAAAAAGAGG + Intronic
987583073 5:19820677-19820699 GGGGAACCCCTTCCAAATACTGG - Intronic
989785012 5:45316591-45316613 GGGTATTCAATTACAAAAAGAGG + Intronic
989805398 5:45597596-45597618 GGGGATTCAATTAGGAAAACAGG + Intronic
990679001 5:58220067-58220089 GGGCATTCAATTACAAAAACAGG + Intergenic
992095510 5:73358980-73359002 TGGGGTGCCCTTACAAAAAGAGG - Intergenic
992249769 5:74865878-74865900 GGGCATTCCCTCACACAAAATGG + Intronic
992709707 5:79439142-79439164 GCGGATTCCTTTAAAAAAAGGGG + Exonic
993591942 5:89805071-89805093 GGGTATTCACTTAGGAAAACAGG + Intergenic
1000673397 5:164090333-164090355 GGGCATTCCCTTTGAAATACTGG - Intergenic
1003270512 6:4603575-4603597 GGGACTTCCCCTGCAAAAACTGG - Intergenic
1003769623 6:9284723-9284745 GGGGCATTCCTTTCAAAAACAGG + Intergenic
1010503049 6:76624801-76624823 GGGTATTCAATTACAAAAAGAGG - Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1020539344 7:9440554-9440576 GGGCATTCAATTAGAAAAACAGG + Intergenic
1021270336 7:18577133-18577155 GTTTATTCCCTTACAAAATCTGG - Intronic
1022720870 7:32941118-32941140 GGAGATGCCCTTACAAAAGGAGG - Intergenic
1023320059 7:38986409-38986431 GGTTATTTCCTTCCAAAAACAGG + Intronic
1023610597 7:41966857-41966879 GAAGCTTCCTTTACAAAAACAGG + Intronic
1031025650 7:116676857-116676879 AGGTATTTCCCTACAAAAACAGG - Intronic
1033921612 7:146400034-146400056 GAGGGTTCTCTTACCAAAACTGG - Intronic
1052371200 9:27666394-27666416 AGGTATTCCCATACACAAACTGG + Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1054814921 9:69465763-69465785 GGGGCTTCCCCTAAAAGAACTGG + Intronic
1190229694 X:48572755-48572777 GAGGAATCCCTGACAATAACAGG + Intergenic
1192287613 X:69755335-69755357 GGTGATACCCTGGCAAAAACAGG - Intronic
1201596444 Y:15675257-15675279 GGGTATTCAAATACAAAAACAGG + Intergenic