ID: 1053296897

View in Genome Browser
Species Human (GRCh38)
Location 9:36921911-36921933
Sequence TCCGAGGGGGTCCCCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053296897_1053296909 21 Left 1053296897 9:36921911-36921933 CCAGGGGAGGGGACCCCCTCGGA No data
Right 1053296909 9:36921955-36921977 CTTACTCCAGATGGGCTCCCCGG No data
1053296897_1053296905 -2 Left 1053296897 9:36921911-36921933 CCAGGGGAGGGGACCCCCTCGGA No data
Right 1053296905 9:36921932-36921954 GACACCTGTGGGGTCAGCAAAGG No data
1053296897_1053296907 12 Left 1053296897 9:36921911-36921933 CCAGGGGAGGGGACCCCCTCGGA No data
Right 1053296907 9:36921946-36921968 CAGCAAAGGCTTACTCCAGATGG No data
1053296897_1053296908 13 Left 1053296897 9:36921911-36921933 CCAGGGGAGGGGACCCCCTCGGA No data
Right 1053296908 9:36921947-36921969 AGCAAAGGCTTACTCCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053296897 Original CRISPR TCCGAGGGGGTCCCCTCCCC TGG (reversed) Intronic