ID: 1053296901

View in Genome Browser
Species Human (GRCh38)
Location 9:36921924-36921946
Sequence GACCCCACAGGTGTCCGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053296901_1053296908 0 Left 1053296901 9:36921924-36921946 CCCCCTCGGACACCTGTGGGGTC No data
Right 1053296908 9:36921947-36921969 AGCAAAGGCTTACTCCAGATGGG No data
1053296901_1053296907 -1 Left 1053296901 9:36921924-36921946 CCCCCTCGGACACCTGTGGGGTC No data
Right 1053296907 9:36921946-36921968 CAGCAAAGGCTTACTCCAGATGG No data
1053296901_1053296909 8 Left 1053296901 9:36921924-36921946 CCCCCTCGGACACCTGTGGGGTC No data
Right 1053296909 9:36921955-36921977 CTTACTCCAGATGGGCTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053296901 Original CRISPR GACCCCACAGGTGTCCGAGG GGG (reversed) Intronic