ID: 1053296905 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:36921932-36921954 |
| Sequence | GACACCTGTGGGGTCAGCAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1053296897_1053296905 | -2 | Left | 1053296897 | 9:36921911-36921933 | CCAGGGGAGGGGACCCCCTCGGA | No data | ||
| Right | 1053296905 | 9:36921932-36921954 | GACACCTGTGGGGTCAGCAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1053296905 | Original CRISPR | GACACCTGTGGGGTCAGCAA AGG | Intronic | ||